Gorilla gorilla (western gorilla) microRNA ggo-mir-10a precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla (western gorilla) microRNA ggo-mir-10a precursor URS000048795E_9593

110 nucleotides
2 databases (ENA, miRBase)
Found in 3 other species
1 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GAUCUGUCUGUCUUCUGUAUAUACCCUGUAGAUCCGAAUUUGUGUAAGGAAUUUUGUGGUCACAAAUUCGUAUCUAGGGGAAUAUGUAGUUGACAUAAACACUCCGCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Homo sapiens microRNA hsa-mir-10a precursor
Pan paniscus microRNA ppa-mir-10a precursor
Pan troglodytes ptr-mir-10a (ENSPTRG00000027667.2)

Publications