Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-33a-5p URS0000483184_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (MalaCards, TarBase, GeneCards, LncBase, miRBase, ENA, RefSeq, MirGeneDB, IntAct, PSICQUIC). Described in 72 papers. Homo sapiens (human) hsa-miR-33a-5p sequence is a product of hsa-miR-33a, MIR33A, miR-33a-5p, miR-33a, miR-33, hsa-miR-33a-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3GAMMA, 14-3-3γ, 170A, 182-FIP, 2700066J21Rik, 2HOR0202, 3D3, 42C, 82-FIP, 8B.

Interactions 22

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-33a-5p interacts with:

Interaction id Participant Synonyms
EBI-25595696 intact:EBI-25470264 EBI-25470264 ENST00000403681 mrna_hmga2
URS0000483184_9606-11 O15118 O15118
URS0000483184_9606-0 O15118 O15118
URS0000483184_9606-1 O43520 O43520
URS0000483184_9606-12 O43520 O43520
URS0000483184_9606-13 O95342 O95342
URS0000483184_9606-2 O95342 O95342
URS0000483184_9606-18 O95477 O95477
URS0000483184_9606-14 O95477 O95477
URS0000483184_9606-15 O95477 O95477
URS0000483184_9606-16 O95477 O95477
URS0000483184_9606-17 O95477 O95477
URS0000483184_9606-5 O95477 O95477
URS0000483184_9606-6 O95477 O95477
URS0000483184_9606-7 O95477 O95477
URS0000483184_9606-8 O95477 O95477
URS0000483184_9606-3 O95477 O95477
URS0000483184_9606-4 O95477 O95477
URS0000483184_9606-19 P22680 P22680
URS0000483184_9606-9 P22680 P22680
URS0000483184_9606-10 P36956 P36956
URS0000483184_9606-20 P36956 P36956

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GUGCAUUGUAGUUGCAUUGCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 73 other species

    1. Aedes aegypti (yellow fever mosquito) aae-miR-33
    2. Alligator mississippiensis ami-miR-33-5p
    3. Anolis carolinensis aca-miR-33-5p
    4. Anopheles gambiae (African malaria mosquito) aga-miR-33-5p
    5. Blattella germanica (German cockroach) Bge-Mir-33_5p (mature (guide))
    6. Bombyx mori bmo-miR-33-5p
    7. Bos taurus (cattle) bta-miR-33a
    8. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-33-5p
    9. Branchiostoma floridae Bfl-Mir-33-P4_5p (mature (guide))
    10. Canis lupus familiaris (dog) Cfa-Mir-33-P1_5p (mature (guide))
    11. Capitella teleta cte-miR-33
    12. Cavia porcellus cpo-miR-33a-5p
    13. Chrysemys picta bellii Cpi-Mir-33-P2_5p (mature (co-guide))
    14. Chrysemys picta cpi-miR-33-5p
    15. Columba livia cli-miR-33-5p
    16. Crassostrea gigas (Pacific oyster) Cgi-Mir-33_5p (mature (guide))
    17. Culex quinquefasciatus cqu-miR-33
    18. Danio rerio Dre-Mir-33-P2_5p* (star (passenger))
    19. Daphnia pulex (common water flea) Dpu-Mir-33_5p* (star (passenger))
    20. Dasypus novemcinctus (nine-banded armadillo) dno-miR-33a-5p
    21. Dinoponera quadriceps dqu-miR-33-5p
    22. Echinops telfairi Ete-Mir-33-P1_5p (mature (guide))
    23. Eisenia fetida Efe-Mir-33_5p (mature (co-guide))
    24. Equus caballus eca-miR-33a
    25. Gadus morhua (Atlantic cod) gmo-miR-33b-5p
    26. Gallus gallus (chicken) Gga-Mir-33-P1_5p (mature (guide))
    27. Heliconius melpomene Hme-Mir-33-P6_5p (mature (guide))
    28. Lottia gigantea Lgi-Mir-33_5p (mature (guide))
    29. Macaca mulatta Mml-Mir-33-P1_5p (mature (guide))
    30. Manduca sexta mse-miR-33
    31. Monodelphis domestica (gray short-tailed opossum) mdo-miR-33-5p
    32. Mus musculus mmu-miR-33-5p
    33. Oreochromis niloticus (Nile tilapia) oni-miR-33b-5p
    34. Ornithorhynchus anatinus Oan-Mir-33-P1_5p (mature (guide))
    35. Oryctolagus cuniculus ocu-miR-33a-5p
    36. Pteropus alecto (black flying fox) pal-miR-33a-5p
    37. Ptychodera flava Pfl-Mir-33_5p (mature (guide))
    38. Python bivittatus pbv-miR-33-5p
    39. Rattus norvegicus rno-miR-33-5p
    40. Saccoglossus kowalevskii Sko-Mir-33_5p* (star (passenger))
    41. Salmo salar ssa-miR-33a-5p
    42. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-33-P1_5p* (star (passenger))
    43. Scyliorhinus torazame (cloudy catshark) Sto-Mir-33-P1_5p (mature (guide))
    44. Taeniopygia guttata (zebra finch) Tgu-Mir-33-P1_5p (mature (guide))
    45. Tribolium castaneum Tca-Mir-33_5p (mature (guide))
    46. Triops cancriformis tcf-miR-33
    47. Tupaia chinensis (Chinese tree shrew) tch-miR-33a-5p
    48. Xenopus laevis xla-miR-33a-5p
    49. Xenopus tropicalis Xtr-Mir-33-P2_5p (mature (guide))