v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-2193170 URS000047D6C7_8364

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUCACAUUGCCAGGGAUUACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Danio rerio dre-miR-23b
  2. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-23-P2_3p (mature (guide))
  3. Gadus morhua (Atlantic cod) gmo-miR-23b-3p
  4. Gorilla gorilla gorilla ggo-miR-23b (MIR23B)
  5. Gorilla gorilla (western gorilla) ggo-miR-23b
  6. Monopterus albus (swamp eel) Mal-Mir-23-P2b_3p (mature (guide))
  7. Mus musculus Mus_musculus piRNA piR-mmu-72514
  8. Pteropus alecto (black flying fox) pal-miR-23b-3p
  9. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62968
  10. Sarcophilus harrisii Sha-Mir-23-P2_3p (mature (guide))
  11. Scyliorhinus torazame Sto-Mir-23-P4_3p (mature (guide))
  12. Sus scrofa (pig) ssc-miR-23b
  13. Takifugu rubripes fru-miR-23b
  14. Tetraodon nigroviridis tni-miR-23b
  15. Tor tambroides (Thai mahseer) miR-23b