Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-23b URS000047D6C7_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-23b: Ssc-mir-23b is a microRNA that is differentially expressed in various tissues and under different conditions. It is a downregulated microRNA that has been found to be differentially expressed by at least four-fold in a study [PMC6560770]. It has been identified as one of the most abundant miRNAs in porcine kidney [PMC3555835]. Ssc-mir-23b has also been found to be upregulated in certain conditions, such as in the presence of certain miRNAs [PMC3555835]. It has been observed that ssc-mir-23b can have multiple precursor targeting regions in the genome [PMC3427155]. In addition, ssc-mir-23b has been found to be downregulated at 7 days post-infection with the ASFV virulent strain, coinciding with immune responses and the death of infected animals [PMC5646143]. Ssc-mir-23b is also involved in fat deposition and its downregulation has been associated with decreased expression levels of TGFBR2 gene [PMC3901342]. Furthermore, ssc-mir-23b is one of the dominant expressed miRNAs in the anterior pituitary gland [PMC4489742]. Overall, ssc-mir-23b plays a role in various biological processes and its expression can be regulated under different conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCACAUUGCCAGGGAUUACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

Publications