Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Theropithecus gelada (gelada baboon) tRNA secondary structure diagram

Theropithecus gelada (gelada baboon) tRNA URS000047C79B_9565

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGGUGUAGCUCAGUGGUAGAGCGCGUGCUUAGCAUGUACGAGGUCCCGGGUUCAAUCCCCGGCACCUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 78 other species

  1. Acinonyx jubatus (cheetah) tRNA
  2. Ailuropoda melanoleuca tRNA-Ala (AGC) (tRNA-Ala-AGC-4-1)
  3. Aotus nancymaae (Ma's night monkey) tRNA
  4. Balaenoptera acutorostrata scammoni tRNA-Ala (AGC) (tRNA-Ala-AGC-1-1)
  5. Balaenoptera musculus (Blue whale) tRNA
  6. Balaenoptera physalus (Fin whale) tRNA
  7. Bison bison bison (north american plains bison) tRNA
  8. Bos grunniens (domestic yak) tRNA
  9. Bos mutus Bos grunniens mutus tRNA
  10. Bos indicus tRNA
  11. Bos indicus x Bos taurus (hybrid cattle) tRNA
  12. Bos taurus tRNA-Ala (AGC) (tRNA-Ala-AGC-1-1)
  13. Callithrix jacchus tRNA-Ala (AGC) (tRNA-Ala-AGC-3-1)
  14. Callorhinus ursinus (northern fur seal) tRNA
  15. Canis lupus dingo (dingo) tRNA
  16. Canis lupus familiaris tRNA-Ala (AGC) (tRNA-Ala-AGC-3-1)
  17. Capra hircus (goat) tRNA
  18. Carlito syrichta tRNA-Ala (AGC) (tRNA-Ala-AGC-1-1)
  19. Catagonus wagneri (Chacoan peccary) tRNA
  20. Sapajus apella Cebus apella (Tufted capuchin) tRNA
  21. Cebus imitator (Panamanian white-faced capuchin) tRNA
  22. Ceratotherium simum simum tRNA-Ala (AGC) (tRNA-Ala-AGC-1-1)
  23. Cercocebus atys (sooty mangabey) tRNA
  24. Cervus elaphus hippelaphus tRNA
  25. Cervus hanglu yarkandensis Cervus elaphus yarkandensis tRNA
  26. Chlorocebus sabaeus tRNA-Ala (AGC) (tRNA-Ala-AGC-3-1)
  27. Colobus angolensis palliatus tRNA
  28. Crocuta crocuta (spotted hyena) tRNA
  29. Delphinapterus leucas (beluga whale) tRNA
  30. Diceros bicornis minor tRNA
  31. Enhydra lutris kenyoni tRNA
  32. Equus asinus (ass) tRNA
  33. Equus caballus tRNA-Ala (AGC) (tRNA-Ala-AGC-1-1)
  34. Felis catus tRNA-Ala (AGC) (tRNA-Ala-AGC-2-1)
  35. Galemys pyrenaicus tRNA
  36. Gorilla gorilla gorilla tRNA-Ala (AGC) (tRNA-Ala-AGC-5-1)
  37. Homo sapiens tRNA-Ala (anticodon AGC) 3-1 (TRA-AGC3-1)
  38. Leptonychotes weddellii (Weddell seal) tRNA
  39. Lipotes vexillifer (Yangtze River dolphin) tRNA
  40. Loxodonta africana tRNA-Ala (AGC) (tRNA-Ala-AGC-2-1)
  41. Lynx canadensis (Canada lynx) tRNA
  42. Lynx pardinus (Spanish lynx) tRNA
  43. Macaca fascicularis (crab-eating macaque) tRNA
  44. Macaca mulatta tRNA-Ala (AGC) (tRNA-Ala-AGC-5-1)
  45. Macaca nemestrina (pig-tailed macaque) tRNA
  46. Mandrillus leucophaeus (drill) tRNA
  47. Neomonachus schauinslandi Monachus schauinslandi (Hawaiian monk seal) tRNA
  48. Monodon monoceros (narwhal) tRNA
  49. Moschus moschiferus (Siberian musk deer) tRNA
  50. Muntiacus reevesi (Chinese muntjac) tRNA
  51. Mustela putorius furo tRNA-Ala (AGC) (tRNA-Ala-AGC-2-1)
  52. Neophocaena asiaeorientalis asiaeorientalis (yangtze finless porpoise) tRNA
  53. Neogale vison Neovison vison tRNA
  54. Nomascus leucogenys tRNA-Ala (AGC) (tRNA-Ala-AGC-3-1)
  55. Nyctereutes procyonoides (raccoon dog) tRNA
  56. Odobenus rosmarus divergens (Pacific walrus) tRNA
  57. Odocoileus virginianus texanus tRNA
  58. Ovis aries tRNA-Ala (AGC) (tRNA-Ala-AGC-1-1)
  59. Pan paniscus (pygmy chimpanzee) tRNA
  60. Panthera leo (lion) tRNA
  61. Panthera tigris altaica (Amur tiger) tRNA
  62. Pan troglodytes tRNA-Ala (AGC) (tRNA-Ala-AGC-5-1)
  63. Papio anubis tRNA-Ala (AGC) (tRNA-Ala-AGC-6-1)
  64. Physeter macrocephalus Physeter catodon (sperm whale) tRNA
  65. Piliocolobus tephrosceles (Ugandan red Colobus) tRNA
  66. Plecturocebus cupreus tRNA-OTHER
  67. Pongo abelii tRNA-Ala (AGC) (tRNA-Ala-AGC-4-1)
  68. Procavia capensis tRNA-Ala (AGC) (tRNA-Ala-AGC-3-1)
  69. Puma concolor (puma) tRNA
  70. Rhinopithecus bieti (Black snub-nosed monkey) tRNA
  71. Rhinopithecus roxellana (golden snub-nosed monkey) tRNA
  72. Saimiri boliviensis boliviensis tRNA-Ala (AGC) (tRNA-Ala-AGC-4-1)
  73. Sousa chinensis (Indo-pacific humpbacked dolphin) tRNA
  74. Sus scrofa tRNA-Ala (AGC) (tRNA-Ala-AGC-2-1)
  75. Tursiops truncatus tRNA-Ala (AGC) (tRNA-Ala-AGC-1-1)
  76. Ursus americanus (American black bear) tRNA
  77. Ursus maritimus (polar bear) tRNA
  78. Vulpes vulpes (red fox) tRNA
Relationships

Molecular Relationships

2D structure

Loading 2D structure...