v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saimiri boliviensis boliviensis tRNA-Ala (AGC) (tRNA-Ala-AGC-4-1) secondary structure diagram

Saimiri boliviensis boliviensis tRNA-Ala (AGC) (tRNA-Ala-AGC-4-1) URS000047C79B_39432

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGGGUGUAGCUCAGUGGUAGAGCGCGUGCUUAGCAUGUACGAGGUCCCGGGUUCAAUCCCCGGCACCUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

  1. Ailuropoda melanoleuca tRNA-Ala (AGC) (tRNA-Ala-AGC-4-1)
  2. Balaenoptera acutorostrata scammoni tRNA-Ala (AGC) (tRNA-Ala-AGC-1-1)
  3. Bos taurus tRNA-Ala (AGC) (tRNA-Ala-AGC-1-1)
  4. Callithrix jacchus tRNA-Ala (AGC) (tRNA-Ala-AGC-3-1)
  5. Canis lupus familiaris tRNA-Ala (AGC) (tRNA-Ala-AGC-3-1)
  6. Carlito syrichta tRNA-Ala (AGC) (tRNA-Ala-AGC-1-1)
  7. Ceratotherium simum simum tRNA-Ala (AGC) (tRNA-Ala-AGC-1-1)
  8. Chlorocebus sabaeus tRNA-Ala (AGC) (tRNA-Ala-AGC-3-1)
  9. Equus caballus tRNA-Ala (AGC) (tRNA-Ala-AGC-1-1)
  10. Felis catus tRNA-Ala (AGC) (tRNA-Ala-AGC-2-1)
  11. Gorilla gorilla gorilla tRNA-Ala (AGC) (tRNA-Ala-AGC-5-1)
  12. Homo sapiens (human) tRNA-Ala (anticodon AGC) 3-1 (TRA-AGC3-1)
  13. Loxodonta africana tRNA-Ala (AGC) (tRNA-Ala-AGC-2-1)
  14. Macaca mulatta tRNA-Ala (AGC) (tRNA-Ala-AGC-5-1)
  15. Mustela putorius furo tRNA-Ala (AGC) (tRNA-Ala-AGC-2-1)
  16. Nomascus leucogenys tRNA-Ala (AGC) (tRNA-Ala-AGC-3-1)
  17. Ovis aries tRNA-Ala (AGC) (tRNA-Ala-AGC-1-1)
  18. Pan troglodytes tRNA-Ala (AGC) (tRNA-Ala-AGC-5-1)
  19. Papio anubis tRNA-Ala (AGC) (tRNA-Ala-AGC-6-1)
  20. Pongo abelii tRNA-Ala (AGC) (tRNA-Ala-AGC-4-1)
  21. Procavia capensis tRNA-Ala (AGC) (tRNA-Ala-AGC-3-1)
  22. Sus scrofa tRNA-Ala (AGC) (tRNA-Ala-AGC-2-1)
  23. Tursiops truncatus tRNA-Ala (AGC) (tRNA-Ala-AGC-1-1)
 2D structure