Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-miR-10-5p URS0000470340_7227

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCCUGUAGAUCCGAAUUUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Aedes aegypti (yellow fever mosquito) aae-miR-10
  2. Bactrocera dorsalis (oriental fruit fly) bdo-miR-10
  3. Blattella germanica Bge-Mir-10-P1-v1_5p (mature (guide))
  4. Cervus elaphus cel-miR-10a
  5. Cochliomyia hominivorax mature cho-miR-10-5p
  6. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-10-5p
  7. Culex quinquefasciatus cqu-miR-10-5p
  8. Drosophila ananassae Dan-Mir-10-P1_5p (mature (guide))
  9. Drosophila mojavensis Dmo-Mir-10-P1_5p (mature (co-guide))
  10. Drosophila simulans Dsi-Mir-10-P1_5p (mature (co-guide))
  11. Drosophila virilis dvi-miR-10-5p
  12. Drosophila yakuba Dya-Mir-10-P1_5p (mature (co-guide))
  13. Heliconius melpomene hme-miR-10
  14. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-10-P1k-v1_5p (mature (guide))
  15. Tribolium castaneum Tca-Mir-10-P1-v1_5p (mature (guide))
Publications