Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-216b-5p URS000046CDA6_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (MirGeneDB, IntAct, miRBase, TarBase, GeneCards, RefSeq, ENA). Described in 34 papers. Homo sapiens (human) hsa-miR-216b-5p sequence is a product of miR-216b, hsa-miR-216b, miR-216b-5p, MIR216B, hsa-miR-216b-5p, miR-216 genes. Found in the human reference genome. Interacts with protein-coding genes, including 182-FIP, 82-FIP, AAT-1, AAT1, AAT1alpha, AAVS1, ACBD3, ACN, ACVRLK4, AD1.

Interactions 2

According to IntAct, Homo sapiens (human) hsa-miR-216b-5p interacts with:

IntAct ID Participant Synonyms
EBI-26366871 intact:EBI-25592332 EBI-25592332 ENST00000382199 mrna_igf2bp2
EBI-26369277 intact:EBI-25592332 EBI-25592332 ENST00000382199 mrna_igf2bp2

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AAAUCUCUGCAGGCAAAUGUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 18 other species

    1. Anolis carolinensis aca-miR-216b-5p
    2. Bos taurus bta-miR-216b
    3. Callithrix jacchus cja-miR-216b
    4. Canis lupus familiaris cfa-miR-216b
    5. Cavia porcellus cpo-miR-216b-5p
    6. Chrysemys picta bellii Cpi-Mir-216-P1b_5p (mature (guide))
    7. Columba livia cli-miR-216b-5p
    8. Cricetulus griseus cgr-miR-216b
    9. Dasypus novemcinctus (nine-banded armadillo) dno-miR-216b-5p
    10. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-216-P1b_5p (mature (co-guide))
    11. Equus caballus eca-miR-216b
    12. Gallus gallus (chicken) gga-miR-216b
    13. Macaca mulatta mml-miR-216b
    14. Mus musculus mmu-miR-216b-5p
    15. Pan troglodytes ptr-miR-216b
    16. Pongo pygmaeus (Bornean orangutan) ppy-miR-216b
    17. Pteropus alecto pal-miR-216b-5p
    18. Python bivittatus (Burmese python) pbv-miR-216b-5p
    19. Rattus norvegicus rno-miR-216b-5p