Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Chrysemys picta bellii (western painted turtle) Cpi-Mir-216-P2a_5p (mature (guide)) URS000046CDA6_8478

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAUCUCUGCAGGCAAAUGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Anolis carolinensis aca-miR-216b-5p
  2. Bos taurus (cattle) bta-miR-216b
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-216b
  4. Canis lupus familiaris cfa-miR-216b
  5. Cavia porcellus (domestic guinea pig) cpo-miR-216b-5p
  6. Columba livia (rock pigeon) cli-miR-216b-5p
  7. Cricetulus griseus cgr-miR-216b
  8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-216b-5p
  9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-216-P2a_5p (mature (co-guide))
  10. Equus caballus eca-miR-216b
  11. Gallus gallus gga-miR-216b
  12. Gekko japonicus Gja-Mir-216-P2a_5p (mature (guide))
  13. Homo sapiens (human) hsa-miR-216b-5p
  14. Macaca mulatta mml-miR-216b
  15. Mus musculus mmu-miR-216b-5p
  16. Oryctolagus cuniculus Ocu-Mir-216-P2a_5p (mature (guide))
  17. Pan troglodytes (chimpanzee) ptr-miR-216b
  18. Pongo pygmaeus (Bornean orangutan) ppy-miR-216b
  19. Pteropus alecto (black flying fox) pal-miR-216b-5p
  20. Python bivittatus (Burmese python) pbv-miR-216b-5p
  21. Rattus norvegicus rno-miR-216b-5p
  22. Sphenodon punctatus Spt-Mir-216-P2a_5p (mature (guide))