Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3915 URS0000458AD2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3915: Hsa-mir-3915 is a microRNA that is predicted to potentially hybridize specifically to the 3'UTR of the ERĪ±36 encoding transcript [PMC6600239]. Several microRNAs, including hsa-mir-3915, may regulate four SNPs [PMC5899355]. Overexpression of hsa-mir-3915 has been observed [PMC8615447]. Hsa-mir-3915 has been found to potentially regulate the expression of HRH4 mRNA [PMC8615447]. The evaluation conducted showed a strong connection between HNMT and hsa-miR-33a4-5p, HRH4 and hsa-mir-3915, EDN1 and hsa-miR-1-30p, as well as hsa-miR-575, SLC23A2, and hsa-miR-27a-5p [PMC8615447]. In different group pairs, differentially expressed miRNAs were observed, including hsa-mir-3915 in the LPS-treated and control groups [PMC9678002].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGAGGAAAAGAUGGUCUUAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications