Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-18b-5p URS00004565E5_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (ENA, TarBase, GeneCards, miRBase, LncBase, MalaCards, RefSeq). Described in 36 papers. Homo sapiens (human) hsa-miR-18b-5p sequence is a product of hsa-miR-18b-5p, MIR18B, miR-18b, miR-18b-5p, miR-18, hsa-miR-18b genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1700010H15RiK, 182-FIP, 3'HEXO, 30ST3B1, 3OST3B1, 4832404P21Rik, 5'OY11.1, 82-FIP, A121, A20.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAAGGUGCAUCUAGUGCAGUUAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 21 other species

    1. Anolis carolinensis aca-miR-18b-5p
    2. Bos taurus Bta-Mir-17-P2b_5p (mature (guide))
    3. Canis lupus familiaris Cfa-Mir-17-P2b_5p (mature (guide))
    4. Cavia porcellus cpo-miR-18b-5p
    5. Chrysemys picta bellii Cpi-Mir-17-P2b_5p (mature (guide))
    6. Cricetulus griseus cgr-miR-18b
    7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-18b-5p
    8. Equus caballus eca-miR-18b
    9. Gallus gallus (chicken) Gga-Mir-17-P2b_5p (mature (guide))
    10. Macaca mulatta mml-miR-18b
    11. Monodelphis domestica mdo-miR-18b-5p
    12. Mus musculus Mus_musculus piRNA piR-mmu-50527342
    13. Ophiophagus hannah (king cobra) oha-miR-18b-5p
    14. Ornithorhynchus anatinus Oan-Mir-17-P2b_5p (mature (guide))
    15. Oryctolagus cuniculus (rabbit) ocu-miR-18b-5p
    16. Pan troglodytes ptr-miR-18b
    17. Pongo pygmaeus (Bornean orangutan) ppy-miR-18b
    18. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-17-P2b_5p (mature (guide))
    19. Scyliorhinus torazame (cloudy catshark) Sto-Mir-17-P2b_5p (mature (co-guide))
    20. Sus scrofa ssc-miR-18b
    21. Xenopus laevis xla-miR-18a-5p
    22. Xenopus tropicalis xtr-miR-18b