Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callorhinchus milii (elephant shark) Cmi-Mir-17-P2c_5p (mature (guide)) URS00004565E5_7868

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAGGUGCAUCUAGUGCAGUUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 31 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-17-P2c_5p (mature (guide))
  2. Anolis carolinensis (green anole) aca-miR-18b-5p
  3. Bos taurus (cattle) Bta-Mir-17-P2c_5p (mature (guide))
  4. Canis lupus familiaris Cfa-Mir-17-P2c_5p (mature (guide))
  5. Cavia porcellus (domestic guinea pig) cpo-miR-18b-5p
  6. Chrysemys picta bellii Cpi-Mir-17-P2c_5p (mature (guide))
  7. Cricetulus griseus (Chinese hamster) cgr-miR-18b
  8. Dasypus novemcinctus dno-miR-18b-5p
  9. Echinops telfairi Ete-Mir-17-P2c_5p (mature (guide))
  10. Equus caballus eca-miR-18b
  11. Gallus gallus (chicken) Gga-Mir-17-P2c_5p (mature (guide))
  12. Gekko japonicus Gja-Mir-17-P2c_5p (mature (guide))
  13. Homo sapiens (human) hsa-miR-18b-5p
  14. Lepisosteus oculatus Loc-Mir-17-P2c_5p (mature (guide))
  15. Macaca mulatta mml-miR-18b
  16. Microcaecilia unicolor Mun-Mir-17-P2c_5p (mature (guide))
  17. Monodelphis domestica mdo-miR-18b-5p
  18. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-50527342
  19. Ophiophagus hannah oha-miR-18b-5p
  20. Ornithorhynchus anatinus (platypus) Oan-Mir-17-P2c_5p (mature (guide))
  21. Oryctolagus cuniculus (rabbit) ocu-miR-18b-5p
  22. Pan troglodytes (chimpanzee) ptr-miR-18b
  23. Pongo pygmaeus ppy-miR-18b
  24. Python bivittatus (Burmese python) Pbv-Mir-17-P2c_5p (mature (guide))
  25. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-17-P2c_5p (mature (guide))
  26. Scyliorhinus torazame Sto-Mir-17-P2c_5p (mature (co-guide))
  27. Sphenodon punctatus (tuatara) Spt-Mir-17-P2c_5p (mature (guide))
  28. Sus scrofa ssc-miR-18b
  29. Taeniopygia guttata Tgu-Mir-17-P2c_5p (mature (guide))
  30. Xenopus laevis (African clawed frog) xla-miR-18a-5p
  31. Xenopus tropicalis xtr-miR-18b