Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3648 URS0000454FAB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-3648: Hsa-mir-3648 is a dysregulated miRNA that has been studied in various diseases, including chronic hepatitis C (CHC) and colorectal cancer (CRC). In CHC, dysregulated miRNAs, except for hsa-mir-3648 and hsa-miR-1908-3p, were disrupted in individuals with an HCV+ infection, indicating a similar miRNA-mediated posttranscriptional regulation [PMC6617112]. In CRC, hsa-mir-3648 is one of the miRNAs that show continuously increasing expression with CRC progression [PMC9304430]. Hsa-mir-3648 has also been identified as one of the top differentially expressed miRNAs in various cancer types, including breast carcinoma [PMC4696739], bladder cancer [PMC9845264], and small cell lung cancer (SCLC) [PMC5929426]. Additionally, hsa-mir-3648 has been found to have human-specific substitutions and is also disrupted in the chimpanzee lineage [PMC4966751]. However, it should be noted that hsa-mir-3648 does not have predicted target genes according to a specific tool used for analysis [PMC3548844]. Overall, hsa-mir-3648 has been implicated in various diseases and shows differential expression patterns that may have diagnostic or prognostic significance.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCCGCGGGGAUCGCCGAGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications