Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-618 URS0000450F92_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-618: Hsa-mir-618 is an upregulated miRNA that has been studied for its interaction with the 3′UTR sequence of ROCK1 and ROCK2 kinases. This interaction was determined through the combination of three online platforms, TargetScan, miRDB, and mirDIP 4.1 [PMC8415262]. In a reanalysis of small RNA-seq data from pediatric T-ALL cases and controls, hsa-mir-618 was found to be one of the top-10 signature miRNAs that could potentially be used for diagnostic purposes in the future [PMC9406077]. In a study on severe asthma patients, hsa-mir-618 was found to be differentially expressed between OCS-treated and non-OCS-treated subjects, suggesting its potential as a treatment marker [PMC9864670]. Hsa-mir-618 was also found to be one of the miRNAs used in a discriminant function to distinguish different types of lymphomas [PMC4335255]. However, the functional role of hsa-mir-618 and its mediation of pleiotropic effects still need to be evaluated through in vitro and in vivo models [PMC8415262]. In a comparison between multiple myeloma (MM) samples and normal samples, hsa-mir-618 was found to be downregulated along with several other miRNAs [PMC7850735].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAACUCUACUUGUCCUUCUGAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Macaca mulatta mml-miR-618
  2. Pan troglodytes (chimpanzee) ptr-miR-618
  3. Pongo pygmaeus ppy-miR-618
Publications