Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila rhopaloa (Fruit fly) tRNA-Val secondary structure diagram

Drosophila rhopaloa (Fruit fly) tRNA-Val URS00004441D1_1041015

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUUCCGUAGUGUAGCGGUUAUCACGUGUGCUUCACACGCACAAGGUCCCCGGUUCGAACCCGGGCGGGAACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 35 other species

  1. Drosophila albomicans (Fruit fly) transfer RNA valine (anticodon CAC)
  2. Drosophila ananassae tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 4)
  3. Drosophila arizonae (Fruit fly) tRNA-Val
  4. Drosophila biarmipes (Fruit fly) transfer RNA valine (anticodon CAC)
  5. Drosophila bipectinata (Fruit fly) tRNA-Val
  6. Drosophila busckii (Fruit fly) tRNA-Val
  7. Drosophila elegans (Fruit fly) tRNA-Val
  8. Drosophila erecta tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 6)
  9. Drosophila eugracilis (Fruit fly) tRNA-Val
  10. Drosophila ficusphila (Fruit fly) tRNA-Val
  11. Drosophila grimshawi tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 4)
  12. Drosophila guanche (Fruit fly) tRNA-Val
  13. Drosophila gunungcola (Fruit fly) transfer RNA valine (anticodon CAC)
  14. Drosophila hydei (Fruit fly) tRNA-Val
  15. Drosophila innubila (Fruit fly) tRNA-Val
  16. Drosophila kikkawai (Fruit fly) tRNA-Val
  17. Drosophila mauritiana (Fruit fly) tRNA-Val
  18. Drosophila melanogaster transfer RNA:Valine-CAC 2-5 (multiple genes)
  19. Drosophila miranda (Fruit fly) tRNA-Val
  20. Drosophila mojavensis tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 4)
  21. Drosophila navojoa (Fruit fly) tRNA-Val
  22. Drosophila obscura (Fruit fly) tRNA-Val
  23. Drosophila persimilis tRNA-Val (CAC) (tRNA-Val-CAC-3 1 to 3)
  24. Drosophila pseudoobscura (Fruit fly) tRNA-Val
  25. Drosophila pseudoobscura pseudoobscura tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 4)
  26. Drosophila santomea (Fruit fly) tRNA-Val
  27. Drosophila sechellia tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 7)
  28. Drosophila simulans tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 6)
  29. Drosophila subobscura (Fruit fly) tRNA-Val
  30. Drosophila subpulchrella (Fruit fly) tRNA-Val
  31. Drosophila suzukii (Fruit fly) tRNA-Val
  32. Drosophila takahashii (Fruit fly) tRNA-Val
  33. Drosophila teissieri (Fruit fly) tRNA-Val
  34. Drosophila virilis tRNA-Val (CAC) (tRNA-Val-CAC-3 1 to 3)
  35. Drosophila yakuba tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 8)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...