v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila gunungcola (Fruit fly) transfer RNA valine (anticodon CAC) secondary structure diagram

Drosophila gunungcola (Fruit fly) transfer RNA valine (anticodon CAC) URS00004441D1_103775

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUUUCCGUAGUGUAGCGGUUAUCACGUGUGCUUCACACGCACAAGGUCCCCGGUUCGAACCCGGGCGGGAACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 35 other species

  1. Drosophila albomicans (Fruit fly) transfer RNA valine (anticodon CAC)
  2. Drosophila ananassae tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 4)
  3. Drosophila arizonae (Fruit fly) tRNA-Val
  4. Drosophila biarmipes (Fruit fly) transfer RNA valine (anticodon CAC)
  5. Drosophila bipectinata (Fruit fly) tRNA-Val
  6. Drosophila busckii (Fruit fly) tRNA-Val
  7. Drosophila elegans (Fruit fly) tRNA-Val
  8. Drosophila erecta tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 6)
  9. Drosophila eugracilis (Fruit fly) tRNA-Val
  10. Drosophila ficusphila (Fruit fly) tRNA-Val
  11. Drosophila grimshawi tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 4)
  12. Drosophila guanche (Fruit fly) tRNA-Val
  13. Drosophila hydei (Fruit fly) tRNA-Val
  14. Drosophila innubila (Fruit fly) tRNA-Val
  15. Drosophila kikkawai (Fruit fly) tRNA-Val
  16. Drosophila mauritiana (Fruit fly) tRNA-Val
  17. Drosophila melanogaster transfer RNA:Valine-CAC 2-5 (multiple genes)
  18. Drosophila miranda (Fruit fly) tRNA-Val
  19. Drosophila mojavensis tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 4)
  20. Drosophila navojoa (Fruit fly) tRNA-Val
  21. Drosophila obscura (Fruit fly) tRNA-Val
  22. Drosophila persimilis tRNA-Val (CAC) (tRNA-Val-CAC-3 1 to 3)
  23. Drosophila pseudoobscura (Fruit fly) tRNA-Val
  24. Drosophila pseudoobscura pseudoobscura tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 4)
  25. Drosophila rhopaloa (Fruit fly) tRNA-Val
  26. Drosophila santomea (Fruit fly) tRNA-Val
  27. Drosophila sechellia tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 7)
  28. Drosophila simulans tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 6)
  29. Drosophila subobscura (Fruit fly) tRNA-Val
  30. Drosophila subpulchrella (Fruit fly) tRNA-Val
  31. Drosophila suzukii (Fruit fly) tRNA-Val
  32. Drosophila takahashii (Fruit fly) tRNA-Val
  33. Drosophila teissieri (Fruit fly) tRNA-Val
  34. Drosophila virilis tRNA-Val (CAC) (tRNA-Val-CAC-3 1 to 3)
  35. Drosophila yakuba tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 8)
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...