Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila gunungcola tRNA-OTHER secondary structure diagram

Drosophila gunungcola tRNA-OTHER URS00004441D1_103775

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUUCCGUAGUGUAGCGGUUAUCACGUGUGCUUCACACGCACAAGGUCCCCGGUUCGAACCCGGGCGGGAACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Drosophila ananassae tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 4)
  2. Drosophila busckii tRNA
  3. Drosophila erecta tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 6)
  4. Drosophila ficusphila tRNA
  5. Drosophila grimshawi tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 4)
  6. Drosophila guanche tRNA.Val
  7. Drosophila melanogaster transfer RNA:Valine-CAC 2-5 (multiple genes)
  8. Drosophila mojavensis tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 4)
  9. Drosophila persimilis tRNA-Val (CAC) (tRNA-Val-CAC-3 1 to 3)
  10. Drosophila pseudoobscura pseudoobscura tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 4)
  11. Drosophila sechellia tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 7)
  12. Drosophila simulans tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 6)
  13. Drosophila virilis tRNA-Val (CAC) (tRNA-Val-CAC-3 1 to 3)
  14. Drosophila yakuba tRNA-Val (CAC) (tRNA-Val-CAC-2 1 to 8)
2D structure