Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) ppy-miR-369-3p URS0000442B0D_9600

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUAAUACAUGGUUGAUCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Bos taurus bta-miR-369-3p
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-369-3p
  3. Capra hircus (goat) chi-miR-369-3p
  4. Cavia porcellus cpo-miR-369-3p
  5. Cervus elaphus (red deer) cel-miR-369-3p
  6. Cricetulus griseus (Chinese hamster) cgr-miR-369-3p
  7. Dasypus novemcinctus dno-miR-369-3p
  8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P5_3p (mature (co-guide))
  9. Equus caballus (horse) eca-miR-369-3p
  10. Gorilla gorilla gorilla ggo-miR-369 (MIR369)
  11. Gorilla gorilla ggo-miR-369
  12. Homo sapiens hsa-miR-369-3p
  13. Macaca mulatta mml-miR-369-3p
  14. Mus musculus (house mouse) mmu-miR-369-3p
  15. Ovis aries oar-miR-369-3p
  16. Pan paniscus (pygmy chimpanzee) ppa-miR-369
  17. Pan troglodytes ptr-miR-369
  18. Pteropus alecto (black flying fox) pal-miR-369-3p
  19. Rattus norvegicus rno-miR-369-3p
  20. Sus scrofa ssc-miR-369
  21. Tupaia chinensis (Chinese tree shrew) tch-miR-369-3p