Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla (western gorilla) ggo-miR-369 URS0000442B0D_9593

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUAAUACAUGGUUGAUCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Bos taurus bta-miR-369-3p
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-369-3p
  3. Capra hircus (goat) chi-miR-369-3p
  4. Cavia porcellus cpo-miR-369-3p
  5. Cervus elaphus (red deer) cel-miR-369-3p
  6. Cricetulus griseus (Chinese hamster) cgr-miR-369-3p
  7. Dasypus novemcinctus dno-miR-369-3p
  8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P5_3p (mature (co-guide))
  9. Equus caballus (horse) eca-miR-369-3p
  10. Gorilla gorilla gorilla ggo-miR-369 (MIR369)
  11. Homo sapiens hsa-miR-369-3p
  12. Macaca mulatta mml-miR-369-3p
  13. Mus musculus (house mouse) mmu-miR-369-3p
  14. Ovis aries oar-miR-369-3p
  15. Pan paniscus (pygmy chimpanzee) ppa-miR-369
  16. Pan troglodytes ptr-miR-369
  17. Pongo pygmaeus (Bornean orangutan) ppy-miR-369-3p
  18. Pteropus alecto (black flying fox) pal-miR-369-3p
  19. Rattus norvegicus rno-miR-369-3p
  20. Sus scrofa ssc-miR-369
  21. Tupaia chinensis (Chinese tree shrew) tch-miR-369-3p