Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1972 URS000042A1A2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-1972: Hsa-mir-1972 is a microRNA that has been found to target BAIAP3 and inhibit its expression in vitro [PMC7906144]. In a study comparing CVID patients at two time points, hsa-mir-1972 was one of the microRNAs that showed significant expression differences [PMC7722869]. Hsa-mir-1972 is also involved in the regulation of THSD4, a down-regulated mRNA, through its interaction with other microRNAs [PMC8799076]. Although hsa-mir-1972 was predicted by multiple databases, it was found to have a miRNA-target interaction with only one gene, TCF3 [PMC5994059]. In the context of LA pathogenesis, hsa-mir-1972 displayed the most significant change in expression and was associated with up-regulated mRNAs in WML tissue [PMC7906144]. Additionally, hsa-mir-1972 showed lower expression levels in plasma of patients with type I LA compared to subjects without LA [PMC7906144]. In patients with AS compared to normal controls, hsa-mir-1972 was found to be downregulated along with other miRNAs [PMC7795580]. These findings suggest that miRNAs like hsa-mir-1972 have potential as biomarkers for disease progression and understanding disease targets and factors [PMC7795580].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGGCCAGGCACAGUGGCUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications