Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Monodelphis domestica (gray short-tailed opossum) mdo-miR-9a-5p URS00004208C5_13616

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Monodelphis domestica. Annotated by 4 databases (MirGeneDB, RefSeq, ENA, miRBase). Monodelphis domestica (gray short-tailed opossum) mdo-miR-9a-5p sequence is a product of MIR9A-3, mdo-miR-9a-5p, MIR9A-1, MIR9A-2, mdo-miR-9a, miR-9, miR-9a-5p, miR-9a genes. Found in the gray short-tailed opossum reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UCUUUGGUUAUCUAGCUGUAUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 106 other species

    1. Acyrthosiphon pisum (pea aphid) api-miR-9a
    2. Aedes aegypti aae-miR-9a
    3. Alligator mississippiensis Ami-Mir-9-P1_5p (mature (guide))
    4. Anolis carolinensis Aca-Mir-9-P1_5p (mature (guide))
    5. Anopheles gambiae aga-miR-9a
    6. Apis mellifera (honey bee) ame-miR-9a-5p
    7. Ascaris suum (pig roundworm) asu-miR-9-5p
    8. Ateles geoffroyi age-miR-9
    9. Blattella germanica Bge-Mir-9-o13_5p (mature (guide))
    10. Bombyx mori bmo-miR-9a-5p
    11. Bos taurus Bta-Mir-9-P1_5p (mature (guide))
    12. Branchiostoma belcheri bbe-miR-9-5p
    13. Branchiostoma floridae Bfl-Mir-9-P6_5p (mature (guide))
    14. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-9
    15. Callorhinchus milii Cmi-Mir-9-P1_5p (mature (guide))
    16. Canis lupus familiaris (dog) cfa-miR-9
    17. Capitella teleta cte-miR-9-5p
    18. Capra hircus (goat) chi-miR-9-5p
    19. Cavia porcellus (domestic guinea pig) cpo-miR-9-5p
    20. Centruroides sculpturatus Csc-Mir-9-P26_5p (mature (guide))
    21. Chrysemys picta bellii (western painted turtle) Cpi-Mir-9-P1_5p (mature (guide))
    22. Chrysemys picta cpi-miR-9-5p
    23. Cochliomyia hominivorax mature cho-miR-9a-5p
    24. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-9a-5p
    25. Columba livia (rock pigeon) cli-miR-9-5p
    26. Crassostrea gigas (Pacific oyster) Cgi-Mir-9-P19_5p (mature (guide))
    27. Danio rerio dre-miR-9-5p
    28. Daphnia magna Dma-Mir-9-o15_5p (mature (guide))
    29. Daphnia pulex (common water flea) dpu-miR-9-5p
    30. Dasypus novemcinctus dno-miR-9-5p
    31. Dinoponera quadriceps dqu-miR-9-5p
    32. Drosophila ananassae dan-miR-9a
    33. Drosophila erecta der-miR-9a
    34. Drosophila grimshawi dgr-miR-9a
    35. Drosophila melanogaster (fruit fly) dme-miR-9a-5p
    36. Drosophila mojavensis dmo-miR-9a
    37. Drosophila persimilis dpe-miR-9a
    38. Drosophila pseudoobscura dps-miR-9a
    39. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294529_df_nrg
    40. Drosophila sechellia dse-miR-9a
    41. Drosophila simulans dsi-miR-9a
    42. Drosophila virilis dvi-miR-9a-5p
    43. Drosophila willistoni dwi-miR-9a
    44. Drosophila yakuba dya-miR-9a
    45. Echinops telfairi Ete-Mir-9-P1_5p (mature (guide))
    46. Eisenia fetida (common brandling worm) Efe-Mir-9-P21_5p (mature (guide))
    47. Eptatretus burgeri (inshore hagfish) Ebu-Mir-9-P6_5p (mature (guide))
    48. Equus caballus eca-miR-9a
    49. Eurosta solidaginis (goldenrod gall fly) miR-9
    50. Gadus morhua (Atlantic cod) gmo-miR-9-5p
    51. Gallus gallus (chicken) gga-miR-9-5p
    52. Gekko japonicus Gja-Mir-9-P1_5p (mature (guide))
    53. Gorilla gorilla ggo-miR-9
    54. Haemonchus contortus hco-miR-9
    55. Heligmosomoides polygyrus hpo-miR-9-5p
    56. Homo sapiens (human) hsa-miR-9-5p
    57. Hyalella azteca miR-9
    58. Ictalurus punctatus ipu-miR-9
    59. Ixodes ricinus iri-miR-9a-5p
    60. Ixodes scapularis (black-legged tick) Isc-Mir-9_5p (mature (guide))
    61. Lagothrix lagotricha (brown woolly monkey) lla-miR-9
    62. Latimeria chalumnae Lch-Mir-9-P1_5p (mature (guide))
    63. Lepisosteus oculatus Loc-Mir-9-P1_5p (mature (guide))
    64. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-9-P23_5p (mature (guide))
    65. Lingula anatina Lan-Mir-9_5p (mature (guide))
    66. Locusta migratoria (migratory locust) lmi-miR-9a-5p
    67. Lottia gigantea lgi-miR-9-5p
    68. Macaca mulatta (Rhesus monkey) mml-miR-9-5p
    69. Macaca nemestrina (pig-tailed macaque) mne-miR-9
    70. Maylandia zebra (zebra mbuna) mze-miR-9
    71. Melibe leonina mle-miR-9-5p
    72. Microcaecilia unicolor Mun-Mir-9-P1_5p (mature (guide))
    73. Monopterus albus Mal-Mir-9-P1b_5p (mature (guide))
    74. Mus musculus (house mouse) mmu-miR-9-5p
    75. Nasonia giraulti ngi-miR-9a
    76. Nasonia longicornis nlo-miR-9a
    77. Nasonia vitripennis nvi-miR-9a
    78. Nautilus pompilius Npo-Mir-9_5p (mature (co-guide))
    79. Ornithorhynchus anatinus Oan-Mir-9-P1_5p (mature (guide))
    80. Oryctolagus cuniculus (rabbit) ocu-miR-9-5p
    81. Oryzias latipes ola-miR-9b-5p
    82. Pan troglodytes (chimpanzee) ptr-miR-9
    83. Paralichthys olivaceus (Japanese flounder) pol-miR-9b-5p
    84. Parasteatoda tepidariorum pte-miR-9-5p
    85. Patiria miniata pmi-miR-9-5p
    86. Polistes canadensis pca-miR-9-5p
    87. Pongo pygmaeus ppy-miR-9
    88. Pteropus alecto pal-miR-9-5p
    89. Ptychodera flava Pfl-Mir-9-v1_5p (mature (co-guide))
    90. Python bivittatus Pbv-Mir-9-P1_5p (mature (guide))
    91. Rattus norvegicus (Norway rat) rno-miR-9a-5p
    92. Saccoglossus kowalevskii Sko-Mir-9-v1_5p (mature (co-guide))
    93. Salmo salar ssa-miR-9a-5p
    94. Sarcophilus harrisii Sha-Mir-9-P1_5p (mature (guide))
    95. Scyliorhinus torazame Sto-Mir-9-P1_5p (mature (guide))
    96. Sphenodon punctatus (tuatara) Spt-Mir-9-P1_5p (mature (co-guide))
    97. Strongylocentrotus purpuratus Spu-Mir-9_5p (mature (guide))
    98. Sus scrofa (pig) ssc-miR-9-1
    99. Taeniopygia guttata (zebra finch) tgu-miR-9-5p
    100. Takifugu rubripes fru-miR-9
    101. Tetraodon nigroviridis tni-miR-9
    102. Tor tambroides miR-9-5p
    103. Tribolium castaneum Tca-Mir-9-o6_5p (mature (guide))
    104. Triops cancriformis tcf-miR-9a-5p
    105. Tupaia chinensis (Chinese tree shrew) tch-miR-9-5p
    106. Xenopus laevis (African clawed frog) Xla-Mir-9-P1d_5p (mature (co-guide))
    107. Xenopus tropicalis (tropical clawed frog) xtr-miR-9a-5p
    Publications New