v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-9 URS00004208C5_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-miR-9: Cfa-mir-9 is a dog brain HTE miRNA that shares sequence homology with rat and human and is a cross-species biomarker candidate for brain injury [PMC4989286]. It has been found that naturally occurring myxomatous mitral valve disease (MMVD) in dogs, which closely resembles MVP in humans, is associated with increased levels of plasma-associated exosomal cfa-mir-9 [PMC7696149]. Cfa-mir-9, along with cfa-miR-181c, cfa-miR-495, and cfa-miR-599, shows changes in expression levels during disease progression and development of heart failure in dogs [PMC5533140]. Cfa-mir-9 and cfa-miR-495 have common target genes such as AGFG1 and FAM126B, which are associated with fibrosis control, cardiomyocyte replication, energetics, cardiac fibrosis, cellular energy production, Ca2+ homeostasis or cardiac remodeling [PMC5533140]. MiRNA target predictions suggest a network involving cfa-mir-9 that deserves further attention [PMC5533140]. The expression of cfa-mir-9 appears to be age-related in dogs [PMC5533140]. In older normal dogs compared to young normal dogs or dogs with MMVD or MMVD-related congestive heart failure (MMVD-CHF), the expression level of cfa-mir-9 is low [PMC5533140]. CFA mir 9 has been found to be consistently elevated in various cancer cell types according to both NGS and qPCR analyses [PMC8379617]. The expression of cfa mir 9 correlates not only with disease progression but also with the age of the dog [PMC8400600].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCUUUGGUUAUCUAGCUGUAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 107 other species

  1. Acyrthosiphon pisum api-miR-9a
  2. Aedes aegypti aae-miR-9a
  3. Alligator mississippiensis (American alligator) Ami-Mir-9-P1_5p (mature (guide))
  4. Anolis carolinensis Aca-Mir-9-P1_5p (mature (guide))
  5. Anopheles gambiae aga-miR-9a
  6. Apis mellifera ame-miR-9a-5p
  7. Ascaris suum asu-miR-9-5p
  8. Ateles geoffroyi age-miR-9
  9. Blattella germanica Bge-Mir-9-o13_5p (mature (guide))
  10. Bombyx mori (domestic silkworm) bmo-miR-9a-5p
  11. Bos taurus Bta-Mir-9-P1_5p (mature (guide))
  12. Branchiostoma belcheri bbe-miR-9-5p
  13. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-9
  14. Callorhinchus milii (elephant shark) Cmi-Mir-9-P1_5p (mature (guide))
  15. Capitella teleta cte-miR-9-5p
  16. Capra hircus chi-miR-9-5p
  17. Cavia porcellus cpo-miR-9-5p
  18. Centruroides sculpturatus Csc-Mir-9-P26_5p (mature (guide))
  19. Chrysemys picta bellii (western painted turtle) Cpi-Mir-9-P1_5p (mature (guide))
  20. Chrysemys picta cpi-miR-9-5p
  21. Cochliomyia hominivorax mature cho-miR-9a-5p
  22. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-9a-5p
  23. Columba livia cli-miR-9-5p
  24. Crassostrea gigas Cgi-Mir-9-P19_5p (mature (guide))
  25. Danio rerio (zebrafish) dre-miR-9-5p
  26. Daphnia magna Dma-Mir-9-o15_5p (mature (guide))
  27. Daphnia pulex (common water flea) dpu-miR-9-5p
  28. Dasypus novemcinctus dno-miR-9-5p
  29. Dinoponera quadriceps dqu-miR-9-5p
  30. Drosophila ananassae dan-miR-9a
  31. Drosophila erecta der-miR-9a
  32. Drosophila grimshawi dgr-miR-9a
  33. Drosophila melanogaster dme-miR-9a-5p
  34. Drosophila mojavensis dmo-miR-9a
  35. Drosophila persimilis dpe-miR-9a
  36. Drosophila pseudoobscura dps-miR-9a
  37. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294529_df_nrg
  38. Drosophila sechellia dse-miR-9a
  39. Drosophila simulans dsi-miR-9a
  40. Drosophila virilis dvi-miR-9a-5p
  41. Drosophila willistoni dwi-miR-9a
  42. Drosophila yakuba dya-miR-9a
  43. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-9-P1_5p (mature (guide))
  44. Eisenia fetida (common brandling worm) Efe-Mir-9-P21_5p (mature (guide))
  45. Eptatretus burgeri (inshore hagfish) Ebu-Mir-9-P6_5p (mature (guide))
  46. Equus caballus eca-miR-9a
  47. Eurosta solidaginis (goldenrod gall fly) miR-9
  48. Gadus morhua gmo-miR-9-5p
  49. Gallus gallus (chicken) gga-miR-9-5p
  50. Gekko japonicus Gja-Mir-9-P1_5p (mature (guide))
  51. Gorilla gorilla gorilla ggo-miR-9 (MIR9)
  52. Gorilla gorilla ggo-miR-9
  53. Haemonchus contortus hco-miR-9
  54. Heligmosomoides polygyrus hpo-miR-9-5p
  55. Homo sapiens hsa-miR-9-5p
  56. Hyalella azteca miR-9
  57. Ictalurus punctatus ipu-miR-9
  58. Ixodes ricinus iri-miR-9a-5p
  59. Ixodes scapularis (black-legged tick) Isc-Mir-9_5p (mature (guide))
  60. Lagothrix lagotricha lla-miR-9
  61. Latimeria chalumnae Lch-Mir-9-P1_5p (mature (guide))
  62. Lepisosteus oculatus (spotted gar) Loc-Mir-9-P1_5p (mature (guide))
  63. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-9-P23_5p (mature (guide))
  64. Lingula anatina Lan-Mir-9_5p (mature (guide))
  65. Locusta migratoria lmi-miR-9a-5p
  66. Lottia gigantea lgi-miR-9-5p
  67. Macaca mulatta mml-miR-9-5p
  68. Macaca nemestrina mne-miR-9
  69. Maylandia zebra mze-miR-9
  70. Melibe leonina mle-miR-9-5p
  71. Microcaecilia unicolor Mun-Mir-9-P1_5p (mature (guide))
  72. Monodelphis domestica (gray short-tailed opossum) mdo-miR-9a-5p
  73. Monopterus albus (swamp eel) Mal-Mir-9-P1b_5p (mature (guide))
  74. Mus musculus (house mouse) mmu-miR-9-5p
  75. Nasonia giraulti ngi-miR-9a
  76. Nasonia longicornis nlo-miR-9a
  77. Nasonia vitripennis (jewel wasp) nvi-miR-9a
  78. Nautilus pompilius Npo-Mir-9_5p (mature (co-guide))
  79. Ornithorhynchus anatinus (platypus) Oan-Mir-9-P1_5p (mature (guide))
  80. Oryctolagus cuniculus ocu-miR-9-5p
  81. Oryzias latipes (Japanese medaka) ola-miR-9b-5p
  82. Pan troglodytes ptr-miR-9
  83. Paralichthys olivaceus (Japanese flounder) pol-miR-9b-5p
  84. Parasteatoda tepidariorum (common house spider) pte-miR-9-5p
  85. Patiria miniata (sea bat) pmi-miR-9-5p
  86. Polistes canadensis pca-miR-9-5p
  87. Pongo pygmaeus ppy-miR-9
  88. Pteropus alecto (black flying fox) pal-miR-9-5p
  89. Ptychodera flava Pfl-Mir-9-v1_5p (mature (co-guide))
  90. Python bivittatus (Burmese python) Pbv-Mir-9-P1_5p (mature (guide))
  91. Rattus norvegicus (Norway rat) rno-miR-9a-5p
  92. Saccoglossus kowalevskii Sko-Mir-9-v1_5p (mature (co-guide))
  93. Salmo salar ssa-miR-9a-5p
  94. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-9-P1_5p (mature (guide))
  95. Scyliorhinus torazame (cloudy catshark) Sto-Mir-9-P1_5p (mature (guide))
  96. Sphenodon punctatus Spt-Mir-9-P1_5p (mature (co-guide))
  97. Strongylocentrotus purpuratus Spu-Mir-9_5p (mature (guide))
  98. Sus scrofa (pig) ssc-miR-9-1
  99. Taeniopygia guttata (zebra finch) tgu-miR-9-5p
  100. Takifugu rubripes (torafugu) fru-miR-9
  101. Tetraodon nigroviridis tni-miR-9
  102. Tor tambroides (Thai mahseer) miR-9-5p
  103. Tribolium castaneum (red flour beetle) Tca-Mir-9-o6_5p (mature (guide))
  104. Triops cancriformis tcf-miR-9a-5p
  105. Tupaia chinensis tch-miR-9-5p
  106. Xenopus laevis Xla-Mir-9-P1d_5p (mature (co-guide))
  107. Xenopus tropicalis (tropical clawed frog) xtr-miR-9a-5p
 Publications