Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-9-5p URS00004208C5_10090

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Mus musculus. Annotated by 7 databases (PirBase, TarBase, RefSeq, ENA, MirGeneDB, miRBase, IntAct). Described in 55 papers. Mus musculus (house mouse) mmu-miR-9-5p sequence is a product of Mir9-3, mmu-miR-9-5p, mmu-miR-9, 9, miR-9-5p, Mir9-1, miR-9, Mir9-2 genes. Interacts with protein-coding genes, including 0610006O14Rik, 0610007I19Rik, 0610007P08Rik, 0610009K11Rik, 0610009O20Rik, 0610010C24Rik, 0610010G05Rik, 0610010I17Rik, 0610010M22Rik, 0610025L01Rik.

Interactions 3

According to IntAct, Mus musculus (house mouse) mmu-miR-9-5p interacts with:

IntAct ID Participant Synonyms
EBI-20770792 intact:EBI-20770760 EBI-20770760 ENSMUST00000206720.1 mrna_cbl
EBI-20795431 intact:EBI-20795417 EBI-20795417 ENSMUST00000000312.11 mrna_cdh1
EBI-20800855 intact:EBI-20812567 EBI-20812567 ENSMUST00000062117.13 mrna_rap2a

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCUUUGGUUAUCUAGCUGUAUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 90 other species

    1. Acyrthosiphon pisum (pea aphid) api-miR-9a
    2. Aedes aegypti aae-miR-9a
    3. Alligator mississippiensis (American alligator) Ami-Mir-9-P1_5p (mature (guide))
    4. Anolis carolinensis (green anole) Aca-Mir-9-P2_5p (mature (guide))
    5. Anopheles gambiae (African malaria mosquito) aga-miR-9a
    6. Apis mellifera (honey bee) ame-miR-9a-5p
    7. Ascaris suum asu-miR-9-5p
    8. Ateles geoffroyi age-miR-9
    9. Blattella germanica (German cockroach) Bge-Mir-9-o14_5p (mature (guide))
    10. Bombyx mori (domestic silkworm) bmo-miR-9a-5p
    11. Bos taurus Bta-Mir-9-P1_5p (mature (guide))
    12. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-9-5p
    13. Branchiostoma floridae (Florida lancelet) Bfl-Mir-9-P6_5p (mature (guide))
    14. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-9
    15. Callorhinchus milii eshark_mir-9_1
    16. Canis lupus familiaris cfa-miR-9
    17. Capitella teleta cte-miR-9-5p
    18. Capra hircus (goat) chi-miR-9-5p
    19. Cavia porcellus (domestic guinea pig) cpo-miR-9-5p
    20. Chrysemys picta bellii (western painted turtle) Cpi-Mir-9-P1_5p (mature (guide))
    21. Chrysemys picta (Painted turtle) cpi-miR-9-5p
    22. Cochliomyia hominivorax mature cho-miR-9a-5p
    23. Cochliomyia macellaria mature cma-miR-9a-5p
    24. Columba livia (rock pigeon) cli-miR-9-5p
    25. Crassostrea gigas Cgi-Mir-9-P12_5p (mature (guide))
    26. Danio rerio dre-miR-9-5p
    27. Daphnia pulex dpu-miR-9-5p
    28. Dasypus novemcinctus dno-miR-9-5p
    29. Dinoponera quadriceps dqu-miR-9-5p
    30. Drosophila ananassae dan-miR-9a
    31. Drosophila erecta der-miR-9a
    32. Drosophila grimshawi dgr-miR-9a
    33. Drosophila melanogaster (fruit fly) dme-miR-9a-5p
    34. Drosophila mojavensis dmo-miR-9a
    35. Drosophila persimilis dpe-miR-9a
    36. Drosophila pseudoobscura dps-miR-9a
    37. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294529_df_nrg
    38. Drosophila sechellia dse-miR-9a
    39. Drosophila simulans dsi-miR-9a
    40. Drosophila virilis dvi-miR-9a-5p
    41. Drosophila willistoni dwi-miR-9a
    42. Drosophila yakuba dya-miR-9a
    43. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-9-P1_5p (mature (guide))
    44. Eisenia fetida Efe-Mir-9-P16_5p (mature (guide))
    45. Equus caballus eca-miR-9a
    46. Eurosta solidaginis (goldenrod gall fly) miR-9
    47. Gadus morhua (Atlantic cod) gmo-miR-9-5p
    48. Gallus gallus gga-miR-9-5p
    49. Gorilla gorilla (western gorilla) ggo-miR-9
    50. Haemonchus contortus (barber pole worm) hco-miR-9
    51. Heligmosomoides polygyrus hpo-miR-9-5p
    52. Homo sapiens hsa-miR-9-5p
    53. Ictalurus punctatus ipu-miR-9
    54. Ixodes ricinus (castor bean tick) iri-miR-9a-5p
    55. Ixodes scapularis (black-legged tick) Isc-Mir-9_5p (mature (guide))
    56. Lagothrix lagotricha lla-miR-9
    57. Lingula anatina Lan-Mir-9_5p (mature (guide))
    58. Locusta migratoria lmi-miR-9a-5p
    59. Lottia gigantea (owl limpet) lgi-miR-9-5p
    60. Macaca mulatta (Rhesus monkey) mml-miR-9-5p
    61. Macaca nemestrina (pig-tailed macaque) mne-miR-9
    62. Maylandia zebra (zebra mbuna) mze-miR-9
    63. Melibe leonina mle-miR-9-5p
    64. Monodelphis domestica (gray short-tailed opossum) mdo-miR-9a-5p
    65. Nasonia giraulti ngi-miR-9a
    66. Nasonia longicornis nlo-miR-9a
    67. Nasonia vitripennis nvi-miR-9a
    68. Ornithorhynchus anatinus Oan-Mir-9-P3_5p (mature (guide))
    69. Oryctolagus cuniculus (rabbit) ocu-miR-9-5p
    70. Oryzias latipes ola-miR-9b-5p
    71. Pan troglodytes ptr-miR-9
    72. Paralichthys olivaceus pol-miR-9b-5p
    73. Parasteatoda tepidariorum (common house spider) pte-miR-9-5p
    74. Patiria miniata pmi-miR-9-5p
    75. Polistes canadensis pca-miR-9-5p
    76. Pongo pygmaeus ppy-miR-9
    77. Pteropus alecto (black flying fox) pal-miR-9-5p
    78. Ptychodera flava Pfl-Mir-9-v1_5p (mature (co-guide))
    79. Rattus norvegicus rno-miR-9a-5p
    80. Saccoglossus kowalevskii Sko-Mir-9-v1_5p (mature (co-guide))
    81. Salmo salar ssa-miR-9a-5p
    82. Scyliorhinus torazame Sto-Mir-9-P2_5p (mature (guide))
    83. Strongylocentrotus purpuratus Spu-Mir-9_5p (mature (guide))
    84. Sus scrofa ssc-miR-9-2
    85. Taeniopygia guttata (zebra finch) tgu-miR-9-5p
    86. Takifugu rubripes fru-miR-9
    87. Tetraodon nigroviridis tni-miR-9
    88. Tor tambroides (Thai mahseer) miR-9-5p
    89. Triops cancriformis tcf-miR-9a-5p
    90. Tupaia chinensis (Chinese tree shrew) tch-miR-9-5p
    91. Xenopus tropicalis (tropical clawed frog) xtr-miR-9a-5p