Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-503 URS000041F764_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-503: ssc-mir-503 is a microRNA that has been found to be up-regulated in various studies [PMC6598998] [PMC7143271] [PMC9651005] [PMC8367414] [PMC6722729]. It has been shown to directly target the EGF gene CDS region and is potentially involved in blood vessel development in the endometrium [PMC7143271]. Additionally, ssc-mir-503 has been found to potentially bind EGF mRNA and is down-regulated in adipocyte differentiation and fatty acid metabolism in pigs [PMC9454643]. It has also been identified as a member of the miR-503 cluster, along with ssc-miR-424-5p, ssc-miR-450a, ssc-miR-450b-5p, ssc-miR450c-5p, and ssc-miR-542-3p, which are commonly affected by ZEN exposure in piglets [PMC9142966]. Furthermore, miRNA-to-mRNA interaction analyses have predicted that ssc-mir-503 may have a putative binding site in the PDK4 3'-UTR region and is up-regulated in the skeletal muscle of AL-T2 gilts [PMC6966835]. Overall, these studies highlight the potential role of ssc-mir-503 in various biological processes and its association with different target genes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAGCGGGAACAGUACUGCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

Publications