v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Echinops telfairi (small Madagascar hedgehog) Ete-Mir-15-P2c_5p (mature (guide)) URS000041F764_9371

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAGCAGCGGGAACAGUACUGCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Bos taurus Bta-Mir-15-P2c_5p (mature (guide))
  2. Canis lupus familiaris Cfa-Mir-15-P2c_5p (mature (guide))
  3. Cavia porcellus (domestic guinea pig) cpo-miR-503-5p
  4. Cervus elaphus cel-miR-503
  5. Dasypus novemcinctus dno-miR-503-5p
  6. Equus caballus (horse) eca-miR-503
  7. Mus musculus mmu-miR-503-5p
  8. Oryctolagus cuniculus (rabbit) Ocu-Mir-15-P2c_5p (mature (guide))
  9. Rattus norvegicus (Norway rat) rno-miR-503-5p
  10. Sus scrofa ssc-miR-503