Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Nomascus leucogenys tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3) secondary structure diagram

Nomascus leucogenys tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3) URS0000416E93_61853

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGCCAGUGGCGCAAUGGAUAACGCGUCUGACUACGGAUCAGAAGAUUCCAGGUUCGACUCCUGGCUGGCUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 188 other species

  1. Acinonyx jubatus (cheetah) tRNA
  2. Acipenser ruthenus (sterlet) tRNA
  3. Ailuropoda melanoleuca tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  4. Albula glossodonta (roundjaw bonefish) tRNA
  5. Ameiurus melas tRNA
  6. Anguilla anguilla tRNA
  7. Aotus nancymaae (Ma's night monkey) tRNA
  8. Arctogadus glacialis (Arctic cod) tRNA-Arg
  9. Bagarius yarrelli (goonch) tRNA
  10. Balaenoptera acutorostrata scammoni tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  11. Balaenoptera musculus (Blue whale) tRNA
  12. Balaenoptera physalus (Fin whale) tRNA
  13. Bison bison bison (north american plains bison) tRNA
  14. Boreogadus saida tRNA-Arg
  15. Bos grunniens (domestic yak) tRNA
  16. Bos mutus Bos grunniens mutus tRNA
  17. Bos indicus tRNA
  18. Bos indicus x Bos taurus (hybrid cattle) tRNA
  19. Bos taurus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  20. Callithrix jacchus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  21. Callorhinus ursinus (northern fur seal) tRNA
  22. Camelus bactrianus (Bactrian camel) tRNA
  23. Camelus dromedarius (Arabian camel) tRNA
  24. Camelus ferus (Wild Bactrian camel) tRNA
  25. Canis lupus dingo (dingo) tRNA
  26. Canis lupus familiaris tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1, tRNA-Arg-ACG-1-2)
  27. Capra hircus (goat) tRNA
  28. Carassius auratus (goldfish) tRNA
  29. Carlito syrichta tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  30. Castor canadensis (American beaver) tRNA
  31. Catagonus wagneri (Chacoan peccary) tRNA
  32. Cavia porcellus tRNA-Arg (ACG) (tRNA-Arg-ACG-2-1, tRNA-Arg-ACG-2-2)
  33. Sapajus apella Cebus apella (Tufted capuchin) tRNA
  34. Cebus imitator (Panamanian white-faced capuchin) tRNA
  35. Ceratotherium simum simum tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  36. Cercocebus atys (sooty mangabey) tRNA
  37. Cervus elaphus hippelaphus tRNA
  38. Cervus hanglu yarkandensis Cervus elaphus yarkandensis tRNA
  39. Chanos chanos (milkfish) tRNA
  40. Chiloscyllium punctatum (brownbanded bambooshark) tRNA
  41. Chinchilla lanigera tRNA
  42. Chlorocebus sabaeus tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1, tRNA-Arg-ACG-1-2)
  43. Choloepus hoffmanni tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  44. Chrysochloris asiatica tRNA
  45. Clarias magur (asian catfish) tRNA
  46. Climacteris rufus Climacteris rufa (rufous treecreeper) tRNA
  47. Colobus angolensis palliatus tRNA
  48. Conger conger tRNA
  49. Cricetulus griseus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  50. Crocuta crocuta (spotted hyena) tRNA
  51. Dasypus novemcinctus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  52. Daubentonia madagascariensis tRNA-Arg
  53. Delphinapterus leucas (beluga whale) tRNA
  54. Dipodomys ordii tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1, tRNA-Arg-ACG-1-2)
  55. Echinops telfairi tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1, tRNA-Arg-ACG-1-2)
  56. Enhydra lutris kenyoni tRNA
  57. Cnephaeus nilssonii Eptesicus nilssoni (northern bat) tRNA
  58. Equus asinus (ass) tRNA
  59. Equus caballus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  60. Erinaceus europaeus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  61. Erpetoichthys calabaricus (reedfish) tRNA
  62. Eschrichtius robustus (grey whale) tRNA
  63. Felis catus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  64. Fukomys damarensis (Damara mole-rat) tRNA
  65. Gadus morhua 'NCC' tRNA-Arg
  66. Gadus morhua tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  67. Galemys pyrenaicus tRNA
  68. Gasterosteus aculeatus (three-spined stickleback) tRNA
  69. Gopherus agassizii (desert tortoise) tRNA
  70. Gopherus evgoodei (goodes thornscrub tortoise) tRNA
  71. Gorilla gorilla gorilla tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  72. Gulo gulo (wolverine) tRNA
  73. Heterocephalus glaber tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  74. Hippoglossus stenolepis tRNA-Arg
  75. Hipposideros armiger tRNA
  76. Homo sapiens tRNA-Arg (anticodon ACG) 1-1 (TRR-ACG1 1 to 3)
  77. Ictidomys tridecemlineatus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  78. Jaculus jaculus (lesser Egyptian jerboa) tRNA
  79. Leptobrachium leishanense (Leishan spiny toad) tRNA
  80. Leptonychotes weddellii (Weddell seal) tRNA
  81. Lipotes vexillifer (Yangtze River dolphin) tRNA
  82. Loxodonta africana tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  83. Lynx canadensis (Canada lynx) tRNA
  84. Lynx pardinus (Spanish lynx) tRNA
  85. Macaca fascicularis (crab-eating macaque) tRNA
  86. Macaca mulatta tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  87. Macaca nemestrina (pig-tailed macaque) tRNA
  88. Mandrillus leucophaeus (drill) tRNA
  89. Marmota marmota marmota (Alpine marmot) tRNA
  90. Marmota monax tRNA
  91. Mesocricetus auratus (golden hamster) tRNA
  92. Microcebus murinus tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1, tRNA-Arg-ACG-1-2)
  93. Microtus ochrogaster (prairie vole) tRNA
  94. Molossus molossus (Pallas's mastiff bat) tRNA
  95. Neomonachus schauinslandi Monachus schauinslandi (Hawaiian monk seal) tRNA
  96. Monodelphis domestica tRNA-Arg (ACG) (tRNA-Arg-ACG-2-1)
  97. Monodon monoceros (narwhal) tRNA
  98. Moschus moschiferus (Siberian musk deer) tRNA
  99. Muntiacus reevesi (Chinese muntjac) tRNA
  100. Muraenolepis orangiensis (Patagonian moray cod) tRNA
  101. Mus caroli tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  102. Mus musculus castaneus tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  103. Mus musculus domesticus tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  104. Mus musculus musculus tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  105. Mus musculus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3, tRNA-Arg-ACG-2 1 to 3)
  106. Mus pahari tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  107. Mus spicilegus (steppe mouse) tRNA
  108. Mus spretus tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  109. Mustela putorius furo tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  110. Myotis brandtii tRNA
  111. Myotis davidii tRNA
  112. Myotis lucifugus tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1, tRNA-Arg-ACG-1-2)
  113. Myotis myotis tRNA
  114. Nannospalax galili (Upper Galilee mountains blind mole rat) tRNA
  115. Neophocaena asiaeorientalis asiaeorientalis (yangtze finless porpoise) tRNA
  116. Neotoma lepida (desert woodrat) tRNA
  117. Neogale vison Neovison vison tRNA
  118. Notamacropus eugenii tRNA-Arg (ACG) (tRNA-Arg-ACG-2-1)
  119. Nyctereutes procyonoides (raccoon dog) tRNA
  120. Ochotona princeps tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1, tRNA-Arg-ACG-1-2)
  121. Octodon degus (degu) tRNA
  122. Odobenus rosmarus divergens (Pacific walrus) tRNA
  123. Odocoileus virginianus texanus tRNA
  124. Ornithorhynchus anatinus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  125. Orycteropus afer afer tRNA
  126. Oryctolagus cuniculus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  127. Otolemur garnettii tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1, tRNA-Arg-ACG-1-2)
  128. Ovis aries tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  129. Pangasianodon hypophthalmus tRNA
  130. Pan paniscus (pygmy chimpanzee) tRNA
  131. Panthera leo (lion) tRNA
  132. Panthera tigris altaica (Amur tiger) tRNA
  133. Pan troglodytes tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  134. Papio anubis tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  135. Peromyscus maniculatus bairdii (prairie deer mouse) tRNA
  136. Phascolarctos cinereus (koala) tRNA
  137. Phocoena sinus (vaquita) tRNA
  138. Phyllostomus discolor (pale spear-nosed bat) tRNA
  139. Physeter macrocephalus Physeter catodon (sperm whale) tRNA
  140. Piliocolobus tephrosceles (Ugandan red Colobus) tRNA
  141. Pipistrellus kuhlii (Kuhl's pipistrelle) tRNA
  142. Plecturocebus cupreus tRNA-OTHER
  143. Pleuronectes platessa (European plaice) tRNA
  144. Polypterus senegalus tRNA
  145. Pongo abelii tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  146. Procavia capensis tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  147. Prolemur simus (greater bamboo lemur) tRNA
  148. Propithecus coquereli (Coquerel's sifaka) tRNA
  149. Pteropus alecto (black flying fox) tRNA
  150. Pteropus vampyrus (large flying fox) tRNA
  151. Puma concolor (puma) tRNA
  152. Rattus norvegicus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  153. Rhinolophus ferrumequinum (greater horseshoe bat) tRNA
  154. Rhinopithecus bieti (Black snub-nosed monkey) tRNA
  155. Rhinopithecus roxellana (golden snub-nosed monkey) tRNA
  156. Rousettus aegyptiacus (Egyptian rousette) tRNA
  157. Saimiri boliviensis boliviensis tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  158. Sarcophilus harrisii tRNA-Arg (ACG) (tRNA-Arg-ACG-2-1)
  159. Sciurus carolinensis (gray squirrel) tRNA
  160. Sciurus vulgaris (Eurasian red squirrel) tRNA
  161. Scyliorhinus torazame (cloudy catshark) tRNA
  162. Sigmodon hispidus tRNA-Arg
  163. Silurus meridionalis tRNA
  164. Sinocyclocheilus anshuiensis tRNA
  165. Sinocyclocheilus grahami tRNA
  166. Sinocyclocheilus rhinocerous tRNA
  167. Sorex araneus tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  168. Sousa chinensis (Indo-pacific humpbacked dolphin) tRNA
  169. Spermophilus dauricus (Daurian ground squirrel) tRNA
  170. Urocitellus parryii Spermophilus parryii (Arctic ground squirrel) tRNA
  171. Suricata suricatta (meerkat) tRNA
  172. Sus scrofa tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  173. Synaphobranchus kaupii (Kaup's arrowtooth eel) tRNA
  174. Takifugu flavidus tRNA
  175. Takifugu rubripes tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1)
  176. Tetraodon nigroviridis tRNA
  177. Theropithecus gelada (gelada baboon) tRNA
  178. Trichechus manatus latirostris tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 3)
  179. Triplophysa rosa (cave loach) tRNA
  180. Triplophysa tibetana tRNA
  181. Tupaia chinensis (Chinese tree shrew) tRNA
  182. Tursiops truncatus tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  183. Ursus americanus (American black bear) tRNA
  184. Ursus maritimus (polar bear) tRNA
  185. Vicugna pacos tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  186. Vombatus ursinus (common wombat) tRNA
  187. Vulpes vulpes (red fox) tRNA
  188. Xenopus laevis (African clawed frog) tRNA
  189. Xiphophorus maculatus (southern platyfish) tRNA
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications