Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Lysine tRNA (tRNA-Lys), predicted by tRNAscan-SE analysis secondary structure diagram

Saccharomyces cerevisiae S288C Lysine tRNA (tRNA-Lys), predicted by tRNAscan-SE analysis URS0000410E6D_559292

Automated summary: This tRNA sequence is 73 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 5 databases (IntAct, GtRNAdb, SGD, ENA, Rfam). Described in 71 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Saccharomyces cerevisiae S288C Lysine tRNA (tRNA-Lys), predicted by tRNAscan-SE analysis sequence is a product of tRNA-Lys-CTT-1-1, tRNA-Lys-CTT-1-6, tRNA-Lys-CTT-1-3, tRNA-Lys-CTT-1-5, tRNA-Lys-CTT-1-9, tRNA-Lys-CTT-1-13, tRNA-Lys-CTT-1-14, tRNA-Lys-CTT-1-11, tRNA-Lys-CTT-1-2, tRNA-Lys-CTT-1-10, tRNA-Lys-CTT-1-4, tRNA-Lys-CTT-1-7, tRNA-Lys-CTT-1-12, tRNA-Lys-CTT-1-8 genes. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 1

According to IntAct, Saccharomyces cerevisiae S288C Lysine tRNA (tRNA-Lys), predicted by tRNAscan-SE analysis interacts with:

Interaction id Participant Synonyms
EBI-16747489 P53617 D6W0U2 EBI-12228 N0868 NRD1 P53617 YNL251C nrd1_yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GCCUUGUUGGCGCAAUCGGUAGCGCGUAUGACUCUUAAUCAUAAGGUUAGGGGUUCGAGCCCCCUACAGGGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 158 other species

    1. [Candida] glabrata CBS 138 tRNA
    2. [Candida] glabrata tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 12)
    3. Lachancea dasiensis tRNA
    4. Lachancea dasiensis tRNA-Lys (CTT) cove score=77.79
    5. Lachancea fermentati tRNA
    6. Lachancea lanzarotensis tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 10)
    7. Lachancea meyersii CBS 8951 tRNA-Lys (CTT) cove score=77.79
    8. Lachancea mirantina tRNA
    9. Lachancea nothofagi CBS 11611 tRNA
    10. Lachancea quebecensis transfer RNA
    11. Lachancea sp. CBS 6924 tRNA-Lys (CTT) cove score=77.79
    12. Lachancea thermotolerans CBS 6340 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
    13. Lachancea thermotolerans partial transfer RNA
    14. Naumovozyma castellii CBS 4309 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
    15. Saccharomyces arboricola H-6 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 13)
    16. Saccharomyces boulardii (nom. inval.) tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
    17. Saccharomyces cerevisiae AWRI796 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
    18. Saccharomyces cerevisiae tRNA-Lys gene, anticodon ctt, len: 73
    19. Saccharomyces cerevisiae CBS 7960 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
    20. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 13)
    21. Saccharomyces cerevisiae CLIB215 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
    22. Saccharomyces cerevisiae CLIB324 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 16)
    23. Saccharomyces cerevisiae CLIB382 tRNA-Lys (CTT) (tRNA-Lys-CTT-2 1 to 6)
    24. Saccharomyces cerevisiae EC1118 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
    25. Saccharomyces cerevisiae EC9-8 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 11)
    26. Saccharomyces cerevisiae FL100 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
    27. Saccharomyces cerevisiae FostersB tRNA-Lys (CTT) (tRNA-Lys-CTT-2 1 to 13)
    28. Saccharomyces cerevisiae FostersO tRNA
    29. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 15)
    30. Saccharomyces cerevisiae Lalvin QA23 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 12)
    31. Saccharomyces cerevisiae P283 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 12)
    32. Saccharomyces cerevisiae P301 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 11)
    33. Saccharomyces cerevisiae PE-2 tRNA-Lys
    34. Saccharomyces cerevisiae PW5 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 8)
    35. Saccharomyces cerevisiae R008 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
    36. Saccharomyces cerevisiae R103 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 12)
    37. Saccharomyces cerevisiae RM11-1a tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
    38. Saccharomyces cerevisiae Sigma1278b tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 12)
    39. Saccharomyces cerevisiae T73 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 12)
    40. Saccharomyces cerevisiae T7 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 13)
    41. Saccharomyces cerevisiae UC5 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 8)
    42. Saccharomyces cerevisiae UFMG A-905 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
    43. Saccharomyces cerevisiae Vin13 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 13)
    44. Saccharomyces cerevisiae VL3 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
    45. Saccharomyces cerevisiae W303 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 13)
    46. Saccharomyces cerevisiae Y10 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 11)
    47. Saccharomyces cerevisiae YJM1078 tRNA-Lys
    48. Saccharomyces cerevisiae YJM1083 tRNA-Lys
    49. Saccharomyces cerevisiae YJM1129 tRNA-Lys
    50. Saccharomyces cerevisiae YJM1133 tRNA-Lys
    51. Saccharomyces cerevisiae YJM1190 tRNA-Lys
    52. Saccharomyces cerevisiae YJM1199 tRNA-Lys
    53. Saccharomyces cerevisiae YJM1202 tRNA-Lys
    54. Saccharomyces cerevisiae YJM1208 tRNA-Lys
    55. Saccharomyces cerevisiae YJM1242 tRNA-Lys
    56. Saccharomyces cerevisiae YJM1244 tRNA-Lys
    57. Saccharomyces cerevisiae YJM1248 tRNA-Lys
    58. Saccharomyces cerevisiae YJM1250 tRNA-Lys
    59. Saccharomyces cerevisiae YJM1252 tRNA-Lys
    60. Saccharomyces cerevisiae YJM1273 tRNA-Lys
    61. Saccharomyces cerevisiae YJM1304 tRNA-Lys
    62. Saccharomyces cerevisiae YJM1307 tRNA-Lys
    63. Saccharomyces cerevisiae YJM1311 tRNA-Lys
    64. Saccharomyces cerevisiae YJM1326 tRNA-Lys
    65. Saccharomyces cerevisiae YJM1332 tRNA-Lys
    66. Saccharomyces cerevisiae YJM1336 tRNA-Lys
    67. Saccharomyces cerevisiae YJM1338 tRNA-Lys
    68. Saccharomyces cerevisiae YJM1341 tRNA-Lys
    69. Saccharomyces cerevisiae YJM1342 tRNA-Lys
    70. Saccharomyces cerevisiae YJM1355 tRNA-Lys
    71. Saccharomyces cerevisiae YJM1356 tRNA-Lys
    72. Saccharomyces cerevisiae YJM1381 tRNA-Lys
    73. Saccharomyces cerevisiae YJM1383 tRNA-Lys
    74. Saccharomyces cerevisiae YJM1385 tRNA-Lys
    75. Saccharomyces cerevisiae YJM1386 tRNA-Lys
    76. Saccharomyces cerevisiae YJM1387 tRNA-Lys
    77. Saccharomyces cerevisiae YJM1388 tRNA-Lys
    78. Saccharomyces cerevisiae YJM1389 tRNA-Lys
    79. Saccharomyces cerevisiae YJM1399 tRNA-Lys
    80. Saccharomyces cerevisiae YJM1400 tRNA-Lys
    81. Saccharomyces cerevisiae YJM1401 tRNA-Lys
    82. Saccharomyces cerevisiae YJM1402 tRNA-Lys
    83. Saccharomyces cerevisiae YJM1415 tRNA-Lys
    84. Saccharomyces cerevisiae YJM1417 tRNA-Lys
    85. Saccharomyces cerevisiae YJM1418 tRNA-Lys
    86. Saccharomyces cerevisiae YJM1419 tRNA-Lys
    87. Saccharomyces cerevisiae YJM1433 tRNA-Lys
    88. Saccharomyces cerevisiae YJM1434 tRNA-Lys
    89. Saccharomyces cerevisiae YJM1439 tRNA-Lys
    90. Saccharomyces cerevisiae YJM1443 tRNA-Lys
    91. Saccharomyces cerevisiae YJM1444 tRNA-Lys
    92. Saccharomyces cerevisiae YJM1447 tRNA-Lys
    93. Saccharomyces cerevisiae YJM1450 tRNA-Lys
    94. Saccharomyces cerevisiae YJM1460 tRNA-Lys
    95. Saccharomyces cerevisiae YJM1463 tRNA-Lys
    96. Saccharomyces cerevisiae YJM1477 tRNA-Lys
    97. Saccharomyces cerevisiae YJM1478 tRNA-Lys
    98. Saccharomyces cerevisiae YJM1479 tRNA-Lys
    99. Saccharomyces cerevisiae YJM1526 tRNA-Lys
    100. Saccharomyces cerevisiae YJM1527 tRNA-Lys
    101. Saccharomyces cerevisiae YJM1549 tRNA-Lys
    102. Saccharomyces cerevisiae YJM1573 tRNA-Lys
    103. Saccharomyces cerevisiae YJM1574 tRNA-Lys
    104. Saccharomyces cerevisiae YJM1592 tRNA-Lys
    105. Saccharomyces cerevisiae YJM1615 tRNA-Lys
    106. Saccharomyces cerevisiae YJM189 tRNA-Lys
    107. Saccharomyces cerevisiae YJM193 tRNA-Lys
    108. Saccharomyces cerevisiae YJM195 tRNA-Lys
    109. Saccharomyces cerevisiae YJM244 tRNA-Lys
    110. Saccharomyces cerevisiae YJM248 tRNA-Lys
    111. Saccharomyces cerevisiae YJM269 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
    112. Saccharomyces cerevisiae YJM270 tRNA-Lys
    113. Saccharomyces cerevisiae YJM271 tRNA-Lys
    114. Saccharomyces cerevisiae YJM320 tRNA-Lys
    115. Saccharomyces cerevisiae YJM326 tRNA-Lys
    116. Saccharomyces cerevisiae YJM428 tRNA-Lys
    117. Saccharomyces cerevisiae YJM450 tRNA-Lys
    118. Saccharomyces cerevisiae YJM451 tRNA-Lys
    119. Saccharomyces cerevisiae YJM453 tRNA-Lys
    120. Saccharomyces cerevisiae YJM456 tRNA-Lys
    121. Saccharomyces cerevisiae YJM470 tRNA-Lys
    122. Saccharomyces cerevisiae YJM541 tRNA-Lys
    123. Saccharomyces cerevisiae YJM554 tRNA-Lys
    124. Saccharomyces cerevisiae YJM555 tRNA-Lys
    125. Saccharomyces cerevisiae YJM627 tRNA-Lys
    126. Saccharomyces cerevisiae YJM681 tRNA-Lys
    127. Saccharomyces cerevisiae YJM682 tRNA-Lys
    128. Saccharomyces cerevisiae YJM683 tRNA-Lys
    129. Saccharomyces cerevisiae YJM689 tRNA-Lys
    130. Saccharomyces cerevisiae YJM693 tRNA-Lys
    131. Saccharomyces cerevisiae YJM969 tRNA-Lys
    132. Saccharomyces cerevisiae YJM972 tRNA-Lys
    133. Saccharomyces cerevisiae YJM975 tRNA-Lys
    134. Saccharomyces cerevisiae YJM978 tRNA-Lys
    135. Saccharomyces cerevisiae YJM981 tRNA-Lys
    136. Saccharomyces cerevisiae YJM984 tRNA-Lys
    137. Saccharomyces cerevisiae YJM987 tRNA-Lys
    138. Saccharomyces cerevisiae YJM990 tRNA-Lys
    139. Saccharomyces cerevisiae YJM993 tRNA-Lys
    140. Saccharomyces cerevisiae YJM996 tRNA-Lys
    141. Saccharomyces cerevisiae YJSH1 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
    142. Saccharomyces eubayanus tRNA-Lys
    143. Saccharomyces kudriavzevii IFO 1802 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 12)
    144. Saccharomyces pastorianus tRNA-Lys
    145. Stenotrophomonas maltophilia tRNA-Lys
    2D structure New