Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces mikatae IFO 1815 tRNA-Lys secondary structure diagram

Saccharomyces mikatae IFO 1815 tRNA-Lys URS0000410E6D_226126

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCUUGUUGGCGCAAUCGGUAGCGCGUAUGACUCUUAAUCAUAAGGUUAGGGGUUCGAGCCCCCUACAGGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 152 other species

  1. Nakaseomyces glabratus CBS 138 tRNA tK(CUU)10
  2. Fusarium falciforme tRNA-Lys
  3. Kazachstania heterogenica tRNA-Lys
  4. Lachancea dasiensis CBS 10888 tRNA
  5. Lachancea dasiensis tRNA-Lys (CTT) cove score=77.79
  6. Lachancea fermentati tRNA
  7. Lachancea lanzarotensis tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 10)
  8. Lachancea meyersii CBS 8951 tRNA-Lys (CTT) cove score=77.79
  9. Lachancea mirantina tRNA
  10. Lachancea nothofagi CBS 11611 tRNA
  11. Lachancea quebecensis transfer RNA
  12. Lachancea sp. 'fantastica' tRNA-Lys (CTT) cove score=77.79
  13. Lachancea thermotolerans CBS 6340 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
  14. Lachancea thermotolerans partial transfer RNA
  15. Nakaseomyces glabratus tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 12)
  16. Naumovozyma castellii CBS 4309 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
  17. Saccharomyces arboricola H-6 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 13)
  18. Saccharomyces boulardii (nom. inval.) tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
  19. Saccharomyces cerevisiae AWRI796 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
  20. Saccharomyces cerevisiae tRNA
  21. Saccharomyces cerevisiae CBS 7960 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
  22. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 13)
  23. Saccharomyces cerevisiae CLIB215 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
  24. Saccharomyces cerevisiae CLIB324 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 16)
  25. Saccharomyces cerevisiae CLIB382 tRNA-Lys (CTT) (tRNA-Lys-CTT-2 1 to 6)
  26. Saccharomyces cerevisiae EC1118 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
  27. Saccharomyces cerevisiae EC9-8 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 11)
  28. Saccharomyces cerevisiae FL100 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
  29. Saccharomyces cerevisiae FostersB tRNA-Lys (CTT) (tRNA-Lys-CTT-2 1 to 13)
  30. Saccharomyces cerevisiae FostersO tRNA
  31. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 15)
  32. Saccharomyces cerevisiae Lalvin QA23 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 12)
  33. Saccharomyces cerevisiae P283 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 12)
  34. Saccharomyces cerevisiae P301 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 11)
  35. Saccharomyces cerevisiae PE-2 tRNA-Lys
  36. Saccharomyces cerevisiae PW5 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 8)
  37. Saccharomyces cerevisiae R008 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
  38. Saccharomyces cerevisiae R103 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 12)
  39. Saccharomyces cerevisiae RM11-1a tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
  40. Saccharomyces cerevisiae S288C tRNA-Lys
  41. Saccharomyces cerevisiae Sigma1278b tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 12)
  42. Saccharomyces cerevisiae synthetic construct tRNA-Lys
  43. Saccharomyces cerevisiae T73 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 12)
  44. Saccharomyces cerevisiae T7 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 13)
  45. Saccharomyces cerevisiae UC5 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 8)
  46. Saccharomyces cerevisiae UFMG A-905 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
  47. Saccharomyces cerevisiae Vin13 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 13)
  48. Saccharomyces cerevisiae VL3 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
  49. Saccharomyces cerevisiae W303 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 13)
  50. Saccharomyces cerevisiae Y10 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 11)
  51. Saccharomyces cerevisiae YJM1078 tRNA-Lys
  52. Saccharomyces cerevisiae YJM1083 tRNA-Lys
  53. Saccharomyces cerevisiae YJM1129 tRNA-Lys
  54. Saccharomyces cerevisiae YJM1133 tRNA-Lys
  55. Saccharomyces cerevisiae YJM1190 tRNA-Lys
  56. Saccharomyces cerevisiae YJM1199 tRNA-Lys
  57. Saccharomyces cerevisiae YJM1202 tRNA-Lys
  58. Saccharomyces cerevisiae YJM1208 tRNA-Lys
  59. Saccharomyces cerevisiae YJM1242 tRNA-Lys
  60. Saccharomyces cerevisiae YJM1244 tRNA-Lys
  61. Saccharomyces cerevisiae YJM1248 tRNA-Lys
  62. Saccharomyces cerevisiae YJM1250 tRNA-Lys
  63. Saccharomyces cerevisiae YJM1252 tRNA-Lys
  64. Saccharomyces cerevisiae YJM1273 tRNA-Lys
  65. Saccharomyces cerevisiae YJM1304 tRNA-Lys
  66. Saccharomyces cerevisiae YJM1307 tRNA-Lys
  67. Saccharomyces cerevisiae YJM1311 tRNA-Lys
  68. Saccharomyces cerevisiae YJM1326 tRNA-Lys
  69. Saccharomyces cerevisiae YJM1332 tRNA-Lys
  70. Saccharomyces cerevisiae YJM1336 tRNA-Lys
  71. Saccharomyces cerevisiae YJM1338 tRNA-Lys
  72. Saccharomyces cerevisiae YJM1341 tRNA-Lys
  73. Saccharomyces cerevisiae YJM1342 tRNA-Lys
  74. Saccharomyces cerevisiae YJM1355 tRNA-Lys
  75. Saccharomyces cerevisiae YJM1356 tRNA-Lys
  76. Saccharomyces cerevisiae YJM1381 tRNA-Lys
  77. Saccharomyces cerevisiae YJM1383 tRNA-Lys
  78. Saccharomyces cerevisiae YJM1385 tRNA-Lys
  79. Saccharomyces cerevisiae YJM1386 tRNA-Lys
  80. Saccharomyces cerevisiae YJM1387 tRNA-Lys
  81. Saccharomyces cerevisiae YJM1388 tRNA-Lys
  82. Saccharomyces cerevisiae YJM1389 tRNA-Lys
  83. Saccharomyces cerevisiae YJM1399 tRNA-Lys
  84. Saccharomyces cerevisiae YJM1400 tRNA-Lys
  85. Saccharomyces cerevisiae YJM1401 tRNA-Lys
  86. Saccharomyces cerevisiae YJM1402 tRNA-Lys
  87. Saccharomyces cerevisiae YJM1415 tRNA-Lys
  88. Saccharomyces cerevisiae YJM1417 tRNA-Lys
  89. Saccharomyces cerevisiae YJM1418 tRNA-Lys
  90. Saccharomyces cerevisiae YJM1419 tRNA-Lys
  91. Saccharomyces cerevisiae YJM1433 tRNA-Lys
  92. Saccharomyces cerevisiae YJM1434 tRNA-Lys
  93. Saccharomyces cerevisiae YJM1439 tRNA-Lys
  94. Saccharomyces cerevisiae YJM1443 tRNA-Lys
  95. Saccharomyces cerevisiae YJM1444 tRNA-Lys
  96. Saccharomyces cerevisiae YJM1447 tRNA-Lys
  97. Saccharomyces cerevisiae YJM1450 tRNA-Lys
  98. Saccharomyces cerevisiae YJM1460 tRNA-Lys
  99. Saccharomyces cerevisiae YJM1463 tRNA-Lys
  100. Saccharomyces cerevisiae YJM1477 tRNA-Lys
  101. Saccharomyces cerevisiae YJM1478 tRNA-Lys
  102. Saccharomyces cerevisiae YJM1479 tRNA-Lys
  103. Saccharomyces cerevisiae YJM1526 tRNA-Lys
  104. Saccharomyces cerevisiae YJM1527 tRNA-Lys
  105. Saccharomyces cerevisiae YJM1549 tRNA-Lys
  106. Saccharomyces cerevisiae YJM1573 tRNA-Lys
  107. Saccharomyces cerevisiae YJM1574 tRNA-Lys
  108. Saccharomyces cerevisiae YJM1592 tRNA-Lys
  109. Saccharomyces cerevisiae YJM1615 tRNA-Lys
  110. Saccharomyces cerevisiae YJM189 tRNA-Lys
  111. Saccharomyces cerevisiae YJM193 tRNA-Lys
  112. Saccharomyces cerevisiae YJM195 tRNA-Lys
  113. Saccharomyces cerevisiae YJM244 tRNA-Lys
  114. Saccharomyces cerevisiae YJM248 tRNA-Lys
  115. Saccharomyces cerevisiae YJM269 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
  116. Saccharomyces cerevisiae YJM270 tRNA-Lys
  117. Saccharomyces cerevisiae YJM271 tRNA-Lys
  118. Saccharomyces cerevisiae YJM320 tRNA-Lys
  119. Saccharomyces cerevisiae YJM326 tRNA-Lys
  120. Saccharomyces cerevisiae YJM428 tRNA-Lys
  121. Saccharomyces cerevisiae YJM450 tRNA-Lys
  122. Saccharomyces cerevisiae YJM451 tRNA-Lys
  123. Saccharomyces cerevisiae YJM453 tRNA-Lys
  124. Saccharomyces cerevisiae YJM456 tRNA-Lys
  125. Saccharomyces cerevisiae YJM470 tRNA-Lys
  126. Saccharomyces cerevisiae YJM541 tRNA-Lys
  127. Saccharomyces cerevisiae YJM554 tRNA-Lys
  128. Saccharomyces cerevisiae YJM555 tRNA-Lys
  129. Saccharomyces cerevisiae YJM627 tRNA-Lys
  130. Saccharomyces cerevisiae YJM681 tRNA-Lys
  131. Saccharomyces cerevisiae YJM682 tRNA-Lys
  132. Saccharomyces cerevisiae YJM683 tRNA-Lys
  133. Saccharomyces cerevisiae YJM689 tRNA-Lys
  134. Saccharomyces cerevisiae YJM693 tRNA-Lys
  135. Saccharomyces cerevisiae YJM969 tRNA-Lys
  136. Saccharomyces cerevisiae YJM972 tRNA-Lys
  137. Saccharomyces cerevisiae YJM975 tRNA-Lys
  138. Saccharomyces cerevisiae YJM978 tRNA-Lys
  139. Saccharomyces cerevisiae YJM981 tRNA-Lys
  140. Saccharomyces cerevisiae YJM984 tRNA-Lys
  141. Saccharomyces cerevisiae YJM987 tRNA-Lys
  142. Saccharomyces cerevisiae YJM990 tRNA-Lys
  143. Saccharomyces cerevisiae YJM993 tRNA-Lys
  144. Saccharomyces cerevisiae YJM996 tRNA-Lys
  145. Saccharomyces cerevisiae YJSH1 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 14)
  146. Saccharomyces eubayanus tRNA-Lys
  147. Saccharomyces kudriavzevii IFO 1802 tRNA-Lys (CTT) (tRNA-Lys-CTT-1 1 to 12)
  148. Saccharomyces kudriavzevii ZP591 tRNA-Lys
  149. Saccharomyces pastorianus tRNA-Lys
  150. Saccharomyces uvarum tRNA-Lys
  151. Stenotrophomonas maltophilia tRNA-Lys
  152. Vector YCy2508 tRNA-Lys
2D structure