Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-124a URS000040D400_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-miR-124a: ssc-mir-124a is a specific type of microRNA that has been found to target the NP genes isolated in all 38 different times [PMC5412334]. It has also been observed that the interaction of ssc-mir-124a and NP was not predicted in a particular study, possibly due to different prediction tools and criteria, or the sequence-specificity of SIV-H1N1/2009 [PMC5412334]. The putative interactions of ssc-mir-124a with its SIV target genes have been found to be maintained throughout virus evolution [PMC2828889]. Additionally, ssc-mir-124a has been shown to regulate the inflammatory response by downregulating IL-1 expression during chronic T. gondii infection [PMC8851844]. It has also been associated with the inactivation of the Notch signaling pathway by potentially targeting TNIP2 and RPS6KA4 [PMC8851844]. Furthermore, ssc-mir-124a expression is decreased during PRRSV infection, leading to the downregulation of CD163 mRNA and protein levels by targeting CD163 mRNA sequence [PMC9522899]. Additionally, ssc-mir-124a has been found to be upregulated in exosomes and is involved in upregulating important signaling molecules such as p-AKT and p-ERK1/2 [PMC8814829]. It is specifically expressed in ER and participates in immune-related pathways along with other miRNAs such as ssc-miR-10b and ssc-miR-128 [PMC6677090] [PMC10000162]. Epigenetic upregulation of ssc-mir-124a has also been shown to attenuate apoptosis and inflammation during CPB2 toxin infection [PMC9253665].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAGGCACGCGGUGAAUGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 41 other species

  1. Acyrthosiphon pisum (pea aphid) api-miR-124
  2. Aedes aegypti Aae-Mir-124_3p (mature (guide))
  3. Alligator mississippiensis ami-miR-124-3p
  4. Anolis carolinensis aca-miR-124a
  5. Ascaris suum asu-miR-124-3p
  6. Bactrocera dorsalis bdo-miR-124
  7. Caenorhabditis brenneri cbn-miR-124
  8. Caenorhabditis briggsae cbr-miR-124a
  9. Caenorhabditis elegans cel-miR-124-3p
  10. Canis lupus familiaris cfa-miR-124
  11. Capitella teleta cte-miR-124
  12. Chrysemys picta (Painted turtle) cpi-miR-124-3p
  13. Crassostrea gigas Cgi-Mir-124-P28_3p (mature (guide))
  14. Dinoponera quadriceps dqu-miR-124-3p
  15. Drosophila ananassae miR-124-RA
  16. Drosophila erecta miR-124-RA
  17. Drosophila persimilis miR-124-RA
  18. Drosophila pseudoobscura pseudoobscura miR-124-RA
  19. Drosophila willistoni miR-124-RA
  20. Drosophila yakuba miR-124-RA
  21. Echinococcus granulosus egr-miR-124a-3p
  22. Echinococcus multilocularis emu-miR-124a-3p
  23. Gadus morhua (Atlantic cod) gmo-miR-124-3p
  24. Heliconius melpomene (postman butterfly) Hme-Mir-124_3p (mature (guide))
  25. Heligmosomoides polygyrus hpo-miR-124-3p
  26. Lingula anatina Lan-Mir-124_3p (mature (co-guide))
  27. Lottia gigantea lgi-miR-124
  28. Lytechinus variegatus lva-miR-124-3p
  29. Manduca sexta mse-miR-124
  30. Melibe leonina mle-miR-124-3p
  31. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8160608
  32. Ornithorhynchus anatinus oan-miR-124a-1-3p
  33. Oryzias latipes ola-miR-124-3p
  34. Petromyzon marinus (sea lamprey) pma-miR-124-3p
  35. Pundamilia nyererei pny-miR-124
  36. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62826
  37. Schmidtea mediterranea (freshwater planarian) sme-miR-124c-3p
  38. Strongylocentrotus purpuratus spu-miR-124
  39. Taeniopygia guttata (zebra finch) tgu-miR-124-3p
  40. Tetranychus urticae tur-miR-124-3p
  41. Xenopus laevis xla-miR-124-3p
Publications