v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Polistes fuscatus (Common paper wasp) tRNA-Ile secondary structure diagram

Polistes fuscatus (Common paper wasp) tRNA-Ile URS000040844E_30207

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCUCCAGUGGCGCAAUUGGUUAGCGCACGGUACUUAUAAUGCCGGGGUUGUGAGUUCGAGCCUCACCUGGAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 81 other species

  1. Acanthoscelides obtectus hypothetical protein
  2. Acromyrmex echinatior (Panamanian leaf-cutter ant) tRNA-Ile
  3. Aethina tumida (Small hive beetle) transfer RNA isoleucine (anticodon UAU)
  4. Amyelois transitella (Naval orange worm) tRNA-Ile
  5. Anthonomus grandis grandis transfer RNA isoleucine (anticodon UAU)
  6. Aphidius gifuensis (Parasitoid wasp) tRNA-Ile
  7. Apis dorsata tRNA-Ile
  8. Apis florea tRNA-Ile
  9. Apis mellifera tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  10. Aromia moschata tRNA-Ile
  11. Athalia rosae tRNA-Ile
  12. Atta cephalotes tRNA LOC105616927
  13. Bactrocera dorsalis tRNA-Ile
  14. Bactrocera latifrons (Solanum fruit fly) tRNA-Ile
  15. Bactrocera tryoni tRNA-Ile
  16. Bicyclus anynana (Squinting bush brown) tRNA-Ile
  17. Bombus huntii (Hunt's bumblebee) transfer RNA isoleucine (anticodon UAU)
  18. Bombus terrestris tRNA LOC110119902
  19. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Ile
  20. Bombyx mandarina (Wild silkworm) tRNA-Ile
  21. Bombyx mori tRNA-Ile (TAT) (tRNA-Ile-TAT-2 1 to 3)
  22. Callosobruchus chinensis (azuki bean weevil) hypothetical protein
  23. Camponotus floridanus tRNA-Ile
  24. Cataglyphis hispanica (Desert ant) transfer RNA isoleucine (anticodon UAU)
  25. Ceratitis capitata (Mediterranean fruit fly) tRNA-Ile
  26. Chelonus insularis (Parasitoid wasp) tRNA-Ile
  27. Copidosoma floridanum (Parasitoid wasp) tRNA-Ile
  28. Cotesia glomerata (White butterfly parasite wasp) tRNA-Ile
  29. Cryptotermes secundus tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  30. Culex quinquefasciatus (Southern house mosquito) tRNA-Ile
  31. Diabrotica virgifera virgifera transfer RNA isoleucine (anticodon UAU)
  32. Drosophila ananassae tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1, tRNA-Ile-TAT-1-2)
  33. Drosophila erecta tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  34. Drosophila grimshawi tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1, tRNA-Ile-TAT-1-2)
  35. Drosophila gunungcola tRNA-OTHER
  36. Drosophila melanogaster transfer RNA:Isoleucine-TAT 1-1 (Dmel_CR32480, Dmel_CR32481)
  37. Drosophila mojavensis tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1, tRNA-Ile-TAT-1-2)
  38. Drosophila persimilis tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  39. Drosophila pseudoobscura pseudoobscura tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1)
  40. Drosophila sechellia tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1, tRNA-Ile-TAT-1-2)
  41. Drosophila simulans tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1, tRNA-Ile-TAT-1-2)
  42. Drosophila virilis tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1, tRNA-Ile-TAT-1-2)
  43. Drosophila willistoni tRNA-Ile (TAT) (tRNA-Ile-TAT-1 1 to 4)
  44. Drosophila yakuba tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1, tRNA-Ile-TAT-1-2)
  45. Dufourea novaeangliae (Bee) tRNA-Ile
  46. Eufriesea mexicana (Bee) tRNA-Ile
  47. Eumeta japonica tRNA-Ile
  48. Exocentrus adspersus tRNA-Ile
  49. Frieseomelitta varia (marmelada) tRNA-Ile
  50. Galleria mellonella (Greater wax moth) tRNA-Ile
  51. Harpegnathos saltator tRNA-Ile
  52. Helicoverpa armigera (Cotton bollworm) transfer RNA isoleucine (anticodon UAU)
  53. Helicoverpa zea tRNA-Ile
  54. Hermetia illucens tRNA-Ile
  55. Leguminivora glycinivorella tRNA-Ile
  56. Leptinotarsa decemlineata (Colorado potato beetle) tRNA-Ile
  57. Linepithema humile (Argentine ant) tRNA-Ile
  58. Lucilia cuprina (Australian sheep blowfly) tRNA-Ile
  59. Manduca sexta tRNA-Ile
  60. Megachile rotundata (Alfalfa leafcutting bee) tRNA-Ile
  61. Molorchus minor tRNA-Ile
  62. Monomorium pharaonis (Pharaoh ant) tRNA-Ile
  63. Musca domestica tRNA MDOA002743
  64. Nasonia vitripennis (Jewel wasp) tRNA-Ile
  65. Neodiprion lecontei tRNA-Ile
  66. Neodiprion pinetum tRNA-Ile
  67. Ooceraea biroi (Clonal raider ant) tRNA-Ile
  68. Orussus abietinus (Parasitic wood wasp) tRNA-Ile
  69. Pararge aegeria tRNA-Ile (TAT) (tRNA-Ile-TAT-1 1 to 4)
  70. Pectinophora gossypiella (Pink bollworm) transfer RNA isoleucine (anticodon UAU)
  71. Pogonomyrmex barbatus tRNA-Ile
  72. Polistes canadensis (Red paper wasp) tRNA-Ile
  73. Polistes dominula tRNA-Ile
  74. Rhagoletis pomonella (Apple magot fly) tRNA-Ile
  75. Rhamnusium bicolor tRNA-Ile
  76. Spodoptera frugiperda tRNA-Ile (TAT) (tRNA-Ile-TAT-1-1, tRNA-Ile-TAT-1-2)
  77. Stomoxys calcitrans (Stable fly) tRNA-Ile
  78. Trichogramma pretiosum (Parasitoid wasp) tRNA-Ile
  79. Trichomalopsis sarcophagae tRNA-OTHER
  80. Venturia canescens (Endoparasitoid wasp) tRNA-Ile
  81. Zerene cesonia (Southern Dogface) tRNA-Ile
 2D structure