Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Echinops telfairi (small Madagascar hedgehog) Ete-Mir-138-P2_5p (mature (guide)) URS000040780F_9371

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUGGUGUUGUGAAUCAGGCCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 51 other species

  1. Alligator mississippiensis Ami-Mir-138-P2_5p (mature (guide))
  2. Anolis carolinensis Aca-Mir-138-P2_5p (mature (guide))
  3. Bos taurus bta-miR-138
  4. Callorhinchus milii Cmi-Mir-138-P1_5p (mature (guide))
  5. Canis lupus familiaris cfa-miR-138a
  6. Cavia porcellus (domestic guinea pig) cpo-miR-138-5p
  7. Cervus elaphus cel-miR-138
  8. Chrysemys picta bellii Cpi-Mir-138-P2_5p (mature (co-guide))
  9. Columba livia cli-miR-138-5p
  10. Danio rerio dre-miR-138-5p
  11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-138-5p
  12. Eptatretus burgeri (inshore hagfish) Ebu-Mir-138-P4_5p (mature (guide))
  13. Equus caballus (horse) eca-miR-138
  14. Gadus morhua (Atlantic cod) Gmo-Mir-138-P1b_5p (mature (guide))
  15. Gallus gallus Gga-Mir-138-P2_5p (mature (guide))
  16. Gekko japonicus Gja-Mir-138-P2_5p (mature (guide))
  17. Gorilla gorilla (western gorilla) ggo-miR-138
  18. Haplochromis burtoni abu-miR-138
  19. Homo sapiens (human) hsa-miR-138-5p
  20. Ictalurus punctatus ipu-miR-138
  21. Latimeria chalumnae (coelacanth) Lch-Mir-138-P2_5p (mature (guide))
  22. Lepisosteus oculatus (spotted gar) Loc-Mir-138-P2_5p (mature (guide))
  23. Macaca fascicularis (crab-eating macaque) microRNA miR-138-5p
  24. Macaca mulatta mml-miR-138-5p
  25. Maylandia zebra (zebra mbuna) mze-miR-138
  26. Microcaecilia unicolor Mun-Mir-138-P1_5p (mature (guide))
  27. Microcebus murinus mmr-miR-138
  28. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-138-P2_5p (mature (guide))
  29. Monopterus albus Mal-Mir-138-P2_5p (mature (guide))
  30. Mus musculus (house mouse) mmu-miR-138-5p
  31. Neolamprologus brichardi (lyretail cichlid) nbr-miR-138
  32. Ophiophagus hannah (king cobra) oha-miR-138-5p
  33. Oreochromis niloticus oni-miR-138
  34. Ornithorhynchus anatinus oan-miR-138-5p
  35. Oryctolagus cuniculus (rabbit) ocu-miR-138-5p
  36. Otolemur garnettii oga-miR-138
  37. Pan troglodytes ptr-miR-138
  38. Petromyzon marinus (sea lamprey) pma-miR-138a
  39. Pongo pygmaeus ppy-miR-138
  40. Pteropus alecto pal-miR-138-5p
  41. Pundamilia nyererei pny-miR-138
  42. Python bivittatus (Burmese python) pbv-miR-138-5p
  43. Rattus norvegicus rno-miR-138-5p
  44. Salmo salar ssa-miR-138-5p
  45. Sarcophilus harrisii sha-miR-138
  46. Scyliorhinus torazame Sto-Mir-138-P1_5p (mature (guide))
  47. Sphenodon punctatus (tuatara) Spt-Mir-138-P2_5p (mature (guide))
  48. Taeniopygia guttata (zebra finch) tgu-miR-138-5p
  49. Tetraodon nigroviridis Tni-Mir-138-P2_5p (mature (guide))
  50. Xenopus laevis xla-miR-138-5p
  51. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-138-P1_5p (mature (guide))