Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-138 URS000040780F_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-miR-138: Bta-mir-138 is a microRNA that is significantly downregulated during LPS induction [PMC9260119]. It is predicted to target the 3'UTR of IKBKE and its expression level is significantly decreased [PMC9260119]. Bta-mir-138, along with other miRNAs such as miR-149-5p, bta-miR-214, bta-miR-504, bta-miR-2387, bta-miR-2466-3p, and bta-miR-6523a, are selected as central hubs regulating annotated signaling pathways [PMC9445238]. Bta-mir-138 and other miRNAs such as bta-mir-2466-3p and bta-mir-214 are also selected based on centrality and betweenness in a time-dependent expression analysis [PMC9445238]. In transition dairy cows, these miRNAs are central hubs that regulate key signal transduction pathways associated with energy homeostasis and immune response [PMC9445238]. Bta-mir 138 is downregulated in the infected compartment compared to the control [PMC4840452]. It has been shown that the expression of bta-mir 138 in peripheral blood mononuclear cells stimulated by Toll-like receptors (TLRs) is increased [PMC8935994]. BTA-MIR 138 may play a role in the immune response induced by P. multocida [PMC8935994]. It simultaneously regulates two genes (ADCY7 and SLC38A4) and YPEL4 (yippee-like 4) which is enriched in the TLR signaling pathway. The expression of BTA-MIR 138 was also significantly increased after P. multocida strain serotype A stimulation. The high-throughput sequencing results were validated by qRT-PCR, which showed an upregulation of bta-mir-138 in CpG ODN stimulated PBMCs [PMC8935994] [PMC4892552].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUGGUGUUGUGAAUCAGGCCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 51 other species

  1. Alligator mississippiensis Ami-Mir-138-P2_5p (mature (guide))
  2. Anolis carolinensis Aca-Mir-138-P2_5p (mature (guide))
  3. Callorhinchus milii Cmi-Mir-138-P1_5p (mature (guide))
  4. Canis lupus familiaris cfa-miR-138a
  5. Cavia porcellus (domestic guinea pig) cpo-miR-138-5p
  6. Cervus elaphus cel-miR-138
  7. Chrysemys picta bellii Cpi-Mir-138-P2_5p (mature (co-guide))
  8. Columba livia cli-miR-138-5p
  9. Danio rerio dre-miR-138-5p
  10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-138-5p
  11. Echinops telfairi Ete-Mir-138-P2_5p (mature (guide))
  12. Eptatretus burgeri (inshore hagfish) Ebu-Mir-138-P4_5p (mature (guide))
  13. Equus caballus (horse) eca-miR-138
  14. Gadus morhua (Atlantic cod) Gmo-Mir-138-P1b_5p (mature (guide))
  15. Gallus gallus Gga-Mir-138-P2_5p (mature (guide))
  16. Gekko japonicus Gja-Mir-138-P2_5p (mature (guide))
  17. Gorilla gorilla (western gorilla) ggo-miR-138
  18. Haplochromis burtoni abu-miR-138
  19. Homo sapiens (human) hsa-miR-138-5p
  20. Ictalurus punctatus ipu-miR-138
  21. Latimeria chalumnae (coelacanth) Lch-Mir-138-P2_5p (mature (guide))
  22. Lepisosteus oculatus (spotted gar) Loc-Mir-138-P2_5p (mature (guide))
  23. Macaca fascicularis (crab-eating macaque) microRNA miR-138-5p
  24. Macaca mulatta mml-miR-138-5p
  25. Maylandia zebra (zebra mbuna) mze-miR-138
  26. Microcaecilia unicolor Mun-Mir-138-P1_5p (mature (guide))
  27. Microcebus murinus mmr-miR-138
  28. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-138-P2_5p (mature (guide))
  29. Monopterus albus Mal-Mir-138-P2_5p (mature (guide))
  30. Mus musculus (house mouse) mmu-miR-138-5p
  31. Neolamprologus brichardi (lyretail cichlid) nbr-miR-138
  32. Ophiophagus hannah (king cobra) oha-miR-138-5p
  33. Oreochromis niloticus oni-miR-138
  34. Ornithorhynchus anatinus oan-miR-138-5p
  35. Oryctolagus cuniculus (rabbit) ocu-miR-138-5p
  36. Otolemur garnettii oga-miR-138
  37. Pan troglodytes ptr-miR-138
  38. Petromyzon marinus (sea lamprey) pma-miR-138a
  39. Pongo pygmaeus ppy-miR-138
  40. Pteropus alecto pal-miR-138-5p
  41. Pundamilia nyererei pny-miR-138
  42. Python bivittatus (Burmese python) pbv-miR-138-5p
  43. Rattus norvegicus rno-miR-138-5p
  44. Salmo salar ssa-miR-138-5p
  45. Sarcophilus harrisii sha-miR-138
  46. Scyliorhinus torazame Sto-Mir-138-P1_5p (mature (guide))
  47. Sphenodon punctatus (tuatara) Spt-Mir-138-P2_5p (mature (guide))
  48. Taeniopygia guttata (zebra finch) tgu-miR-138-5p
  49. Tetraodon nigroviridis Tni-Mir-138-P2_5p (mature (guide))
  50. Xenopus laevis xla-miR-138-5p
  51. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-138-P1_5p (mature (guide))
Publications