Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nomascus leucogenys (northern white-cheeked gibbon) nle-let-7i URS00004023EA_61853

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGUAGUUUGUGCUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis (American alligator) Ami-Let-7-P2c2_5p (mature (guide))
  2. Anolis carolinensis aca-let-7i-5p
  3. Bos taurus (cattle) bta-let-7i
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-let-7i
  5. Canis lupus familiaris Cfa-Let-7-P2c2_5p (mature (guide))
  6. Capra hircus (goat) chi-let-7i-5p
  7. Cavia porcellus cpo-let-7i-5p
  8. Cervus elaphus (red deer) cel-let-7i
  9. Chrysemys picta bellii (western painted turtle) Cpi-Let-7-P2c2_5p (mature (guide))
  10. Chrysemys picta cpi-let-7i-5p
  11. Danio rerio dre-let-7i
  12. Dasypus novemcinctus (nine-banded armadillo) dno-let-7i-5p
  13. Echinops telfairi Ete-Let-7-P2c2_5p (mature (guide))
  14. Gadus morhua (Atlantic cod) Gmo-Let-7-P2c2b_5p (mature (guide))
  15. Gallus gallus (chicken) Gga-Let-7-P2c2_5p (mature (guide))
  16. Gekko japonicus Gja-Let-7-P2c2_5p (mature (guide))
  17. Haplochromis burtoni abu-let-7i
  18. Homo sapiens hsa-let-7i-5p
  19. Ictalurus punctatus (channel catfish) ipu-let-7i
  20. Latimeria chalumnae Lch-Let-7-P2c2_5p (mature (guide))
  21. Lepisosteus oculatus Loc-Let-7-P2c2_5p (mature (guide))
  22. Macaca mulatta mml-let-7i-5p
  23. Maylandia zebra mze-let-7i
  24. Microcaecilia unicolor Mun-Let-7-P2c2_5p (mature (guide))
  25. Monodelphis domestica Mdo-Let-7-P2c2_5p (mature (guide))
  26. Monopterus albus Mal-Let-7-P2c2b_5p (mature (guide))
  27. Mus musculus (house mouse) mmu-let-7i-5p
  28. Neolamprologus brichardi (lyretail cichlid) nbr-let-7i
  29. Ophiophagus hannah (king cobra) oha-let-7i-5p
  30. Oreochromis niloticus oni-let-7i
  31. Ornithorhynchus anatinus Oan-Let-7-P2c2_5p (mature (guide))
  32. Oryctolagus cuniculus ocu-let-7i-5p
  33. Otolemur garnettii oga-let-7i
  34. Ovis aries oar-let-7i
  35. Pan paniscus ppa-let-7i
  36. Pan troglodytes (chimpanzee) ptr-let-7i
  37. Papio hamadryas pha-let-7i
  38. Pongo pygmaeus ppy-let-7i
  39. Pteropus alecto (black flying fox) pal-let-7i-5p
  40. Pundamilia nyererei pny-let-7i
  41. Python bivittatus pbv-let-7i-5p
  42. Rattus norvegicus (Norway rat) rno-let-7i-5p
  43. Salmo salar ssa-let-7i-5p
  44. Sarcophilus harrisii Sha-Let-7-P2c2_5p (mature (guide))
  45. Sphenodon punctatus (tuatara) Spt-Let-7-P2c2_5p (mature (guide))
  46. Taeniopygia guttata (zebra finch) tgu-let-7i-5p
  47. Takifugu rubripes fru-let-7i
  48. Tetraodon nigroviridis (spotted green pufferfish) tni-let-7i
  49. Tor tambroides let-7i
  50. Tupaia chinensis (Chinese tree shrew) tch-let-7i-5p
  51. Xenopus laevis (African clawed frog) Xla-Let-7-P2c2_5p (mature (guide))
  52. Xenopus tropicalis Xtr-Let-7-P2c2_5p (mature (guide))