Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Blattella germanica tRNA-Thr (TGT) (tRNA-Thr-TGT-4 1 to 6) secondary structure diagram

Blattella germanica tRNA-Thr (TGT) (tRNA-Thr-TGT-4 1 to 6) URS00003F44FF_6973

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCUCUUUAGCUCAGUGGCAGAGCACUGGUCUUGUAAACCAGGGGUCGUGAGUUCAAUCCUCACAGGAGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 58 other species

  1. Acanthoscelides obtectus hypothetical protein
  2. Aethina tumida (Small hive beetle) transfer RNA threonine (anticodon UGU)
  3. Agrilus planipennis tRNA-Thr
  4. Anthonomus grandis grandis (Boll weevil) transfer RNA threonine (anticodon UGU)
  5. Aromia moschata tRNA-OTHER
  6. Bactrocera dorsalis tRNA-Thr
  7. Bactrocera latifrons (Solanum fruit fly) tRNA-Thr
  8. Bactrocera tryoni tRNA-Thr
  9. Callosobruchus analis hypothetical protein
  10. Callosobruchus chinensis (azuki bean weevil) hypothetical protein
  11. Ceratitis capitata tRNA-Thr
  12. Danaus plexippus plexippus tRNA
  13. Dendroctonus ponderosae tRNA-Thr
  14. Diabrotica virgifera virgifera (Western corn rootworm) transfer RNA threonine (anticodon UGU)
  15. Drosophila ananassae tRNA-Thr (TGT) (tRNA-Thr-TGT-2 1 to 4)
  16. Drosophila busckii tRNA
  17. Drosophila erecta tRNA-Thr (TGT) (tRNA-Thr-TGT-1 1 to 5)
  18. Drosophila ficusphila tRNA
  19. Drosophila grimshawi tRNA-Thr (TGT) (tRNA-Thr-TGT-3 1 to 4)
  20. Drosophila guanche tRNA.Thr
  21. Drosophila gunungcola tRNA-OTHER
  22. Drosophila melanogaster transfer RNA:Threonine-TGT 2-1 (Dmel_CR30257, Dmel_CR30506, Dmel_CR31432, Dmel_CR45106, Dmel_CR45107)
  23. Drosophila mojavensis tRNA-Thr (TGT) (tRNA-Thr-TGT-2 1 to 4)
  24. Drosophila persimilis tRNA-Thr (TGT) (tRNA-Thr-TGT-2 1 to 3)
  25. Drosophila pseudoobscura pseudoobscura tRNA-Thr (TGT) (tRNA-Thr-TGT-2 1 to 4)
  26. Drosophila sechellia tRNA-Thr (TGT) (tRNA-Thr-TGT-2 1 to 4)
  27. Drosophila simulans tRNA-Thr (TGT) (tRNA-Thr-TGT-2 1 to 4)
  28. Drosophila virilis tRNA-Thr (TGT) (tRNA-Thr-TGT-1 1 to 6)
  29. Drosophila willistoni tRNA-Thr (TGT) (tRNA-Thr-TGT-3 1 to 3)
  30. Drosophila yakuba tRNA-Thr (TGT) (tRNA-Thr-TGT-1 1 to 5)
  31. Dryococelus australis tRNA-OTHER
  32. Exocentrus adspersus tRNA-OTHER
  33. Glossina austeni tRNA tRNA-Thr
  34. Glossina brevipalpis tRNA tRNA-Thr
  35. Glossina fuscipes fuscipes tRNA
  36. Glossina morsitans morsitans tRNA tRNA-Thr
  37. Glossina pallidipes tRNA tRNA-Thr
  38. Glossina palpalis gambiensis tRNA tRNA-Thr
  39. Heliconius melpomene (Postman butterfly) tRNA HMEL007454
  40. Hermetia illucens (Black soldier fly) tRNA-Thr
  41. Leptinotarsa decemlineata tRNA-Thr
  42. Lucilia cuprina (Australian sheep blowfly) tRNA-Thr for anticodon UGU
  43. Megaselia scalaris (Coffin fly) tRNA-Thr for anticodon UGU
  44. Melitaea cinxia misc RNA ENSMCXG00005023579.1
  45. Methanobacterium sp. tRNA-Thr
  46. Molorchus minor tRNA-OTHER
  47. Musca domestica tRNA MDOA014875
  48. Onthophagus taurus (Dung beetle) tRNA-Thr
  49. Operophtera brumata tRNA
  50. Oryctes borbonicus tRNA
  51. Pararge aegeria tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  52. Plutella xylostella tRNA-Thr
  53. Rhagoletis pomonella (Apple magot fly) tRNA-Thr
  54. Rhamnusium bicolor tRNA-OTHER
  55. Rhodnius prolixus (Kissing bug) tRNA tRNA-Thr
  56. Sitophilus oryzae tRNA-Thr
  57. Stomoxys calcitrans tRNA-Thr
  58. Tribolium castaneum tRNA-Thr for anticodon UGU
2D structure