v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pararge aegeria tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1) secondary structure diagram

Pararge aegeria tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1) URS00003F44FF_116150

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCCUCUUUAGCUCAGUGGCAGAGCACUGGUCUUGUAAACCAGGGGUCGUGAGUUCAAUCCUCACAGGAGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 58 other species

  1. Acanthoscelides obtectus hypothetical protein
  2. Aethina tumida (Small hive beetle) transfer RNA threonine (anticodon UGU)
  3. Agrilus planipennis tRNA-Thr
  4. Anthonomus grandis grandis (Boll weevil) transfer RNA threonine (anticodon UGU)
  5. Aromia moschata tRNA-OTHER
  6. Bactrocera dorsalis tRNA-Thr
  7. Bactrocera latifrons (Solanum fruit fly) tRNA-Thr
  8. Bactrocera tryoni tRNA-Thr
  9. Blattella germanica tRNA-Thr (TGT) (tRNA-Thr-TGT-4 1 to 6)
  10. Callosobruchus analis hypothetical protein
  11. Callosobruchus chinensis (azuki bean weevil) hypothetical protein
  12. Ceratitis capitata tRNA-Thr
  13. Danaus plexippus plexippus tRNA
  14. Dendroctonus ponderosae tRNA-Thr
  15. Diabrotica virgifera virgifera (Western corn rootworm) transfer RNA threonine (anticodon UGU)
  16. Drosophila ananassae tRNA-Thr (TGT) (tRNA-Thr-TGT-2 1 to 4)
  17. Drosophila busckii tRNA
  18. Drosophila erecta tRNA-Thr (TGT) (tRNA-Thr-TGT-1 1 to 5)
  19. Drosophila ficusphila tRNA
  20. Drosophila grimshawi tRNA-Thr (TGT) (tRNA-Thr-TGT-3 1 to 4)
  21. Drosophila guanche tRNA.Thr
  22. Drosophila gunungcola tRNA-OTHER
  23. Drosophila melanogaster transfer RNA:Threonine-TGT 2-1 (Dmel_CR30257, Dmel_CR30506, Dmel_CR31432, Dmel_CR45106, Dmel_CR45107)
  24. Drosophila mojavensis tRNA-Thr (TGT) (tRNA-Thr-TGT-2 1 to 4)
  25. Drosophila persimilis tRNA-Thr (TGT) (tRNA-Thr-TGT-2 1 to 3)
  26. Drosophila pseudoobscura pseudoobscura tRNA-Thr (TGT) (tRNA-Thr-TGT-2 1 to 4)
  27. Drosophila sechellia tRNA-Thr (TGT) (tRNA-Thr-TGT-2 1 to 4)
  28. Drosophila simulans tRNA-Thr (TGT) (tRNA-Thr-TGT-2 1 to 4)
  29. Drosophila virilis tRNA-Thr (TGT) (tRNA-Thr-TGT-1 1 to 6)
  30. Drosophila willistoni tRNA-Thr (TGT) (tRNA-Thr-TGT-3 1 to 3)
  31. Drosophila yakuba tRNA-Thr (TGT) (tRNA-Thr-TGT-1 1 to 5)
  32. Dryococelus australis tRNA-OTHER
  33. Exocentrus adspersus tRNA-OTHER
  34. Glossina austeni tRNA tRNA-Thr
  35. Glossina brevipalpis tRNA tRNA-Thr
  36. Glossina fuscipes fuscipes tRNA
  37. Glossina morsitans morsitans tRNA tRNA-Thr
  38. Glossina pallidipes tRNA tRNA-Thr
  39. Glossina palpalis gambiensis tRNA tRNA-Thr
  40. Heliconius melpomene (Postman butterfly) tRNA HMEL007454
  41. Hermetia illucens (Black soldier fly) tRNA-Thr
  42. Leptinotarsa decemlineata tRNA-Thr
  43. Lucilia cuprina (Australian sheep blowfly) tRNA-Thr for anticodon UGU
  44. Megaselia scalaris (Coffin fly) tRNA-Thr for anticodon UGU
  45. Melitaea cinxia misc RNA ENSMCXG00005023579.1
  46. Methanobacterium sp. tRNA-Thr
  47. Molorchus minor tRNA-OTHER
  48. Musca domestica tRNA MDOA014875
  49. Onthophagus taurus (Dung beetle) tRNA-Thr
  50. Operophtera brumata tRNA
  51. Oryctes borbonicus tRNA
  52. Plutella xylostella tRNA-Thr
  53. Rhagoletis pomonella (Apple magot fly) tRNA-Thr
  54. Rhamnusium bicolor tRNA-OTHER
  55. Rhodnius prolixus (Kissing bug) tRNA tRNA-Thr
  56. Sitophilus oryzae tRNA-Thr
  57. Stomoxys calcitrans tRNA-Thr
  58. Tribolium castaneum tRNA-Thr for anticodon UGU
 2D structure