Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-365a-3p URS00003E7283_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (MalaCards, RefSeq, GeneCards, TarBase, ENA, IntAct, miRBase, MirGeneDB, LncBase). Described in 61 papers. Homo sapiens (human) hsa-miR-365a-3p sequence is a product of MIR365A, hsa-miR-365b, hsa-miR-365a-3p, hsa-miR-365b-3p, miR-365b, hsa-miR-365a, miR-365a-3p, HSA-MIR-RG-50 variant 1, MIR-RG-50 variant 1, MIR365B, miR-365, miR-365a, miR-365b-3p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-8D, 14-3-3-zeta, 182-FIP, 20D7-FC4, 2700066J21Rik, 82-FIP, A121, ABCA5, ABCC1, ABHD10.

Interactions 3

According to IntAct, Homo sapiens (human) hsa-miR-365a-3p interacts with:

IntAct ID Participant Synonyms
EBI-22114610 intact:EBI-20740126 EBI-20740126 ENST00000640368 mrna_pax6
EBI-22114834 intact:EBI-20740126 EBI-20740126 ENST00000640368 mrna_pax6
EBI-22114904 intact:EBI-20740126 EBI-20740126 ENST00000640368 mrna_pax6

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAAUGCCCCUAAAAAUCCUUAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 46 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-193-P2a_3p (mature (guide))
    2. Anolis carolinensis (green anole) aca-miR-365-3p
    3. Bos taurus bta-miR-365-3p
    4. Callithrix jacchus cja-miR-365
    5. Callorhinchus milii eshark_mir-365_1
    6. Canis lupus familiaris cfa-miR-365
    7. Capra hircus chi-miR-365-3p
    8. Cavia porcellus (domestic guinea pig) cpo-miR-365-3p
    9. Cervus elaphus (red deer) cel-miR-365-3p
    10. Chrysemys picta bellii Cpi-Mir-193-P2a_3p (mature (guide))
    11. Columba livia (rock pigeon) Cli-Mir-193-P2a_3p (mature (guide))
    12. Cricetulus griseus cgr-miR-365-3p
    13. Cyprinus carpio (common carp) ccr-miR-365
    14. Danio rerio (zebrafish) dre-miR-365
    15. Dasypus novemcinctus dno-miR-365-3p
    16. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-193-P2a_3p (mature (guide))
    17. Eptesicus fuscus efu-miR-365
    18. Equus caballus (horse) eca-miR-365
    19. Gadus morhua gmo-miR-365-3p
    20. Gallus gallus (chicken) gga-miR-365-3p
    21. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-365
    22. Macaca mulatta (Rhesus monkey) mml-miR-365-3p
    23. Maylandia zebra (zebra mbuna) mze-miR-365
    24. Microcebus murinus (gray mouse lemur) mmr-miR-365
    25. Monodelphis domestica mdo-miR-365-3p
    26. Mus musculus (house mouse) mmu-miR-365-3p
    27. Neolamprologus brichardi nbr-miR-365
    28. Nomascus leucogenys nle-miR-365
    29. Ophiophagus hannah oha-miR-365a-3p
    30. Oreochromis niloticus oni-miR-365
    31. Ornithorhynchus anatinus oan-miR-365-3p
    32. Oryctolagus cuniculus ocu-miR-365-3p
    33. Otolemur garnettii (small-eared galago) oga-miR-365
    34. Pan troglodytes (chimpanzee) ptr-miR-365
    35. Pongo pygmaeus (Bornean orangutan) ppy-miR-365
    36. Pteropus alecto (black flying fox) pal-miR-365b-3p
    37. Pundamilia nyererei pny-miR-365
    38. Rattus norvegicus rno-miR-365-3p
    39. Salmo salar (Atlantic salmon) ssa-miR-365-3p
    40. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-193-P2a_3p (mature (guide))
    41. Sus scrofa (pig) ssc-miR-365-3p
    42. Taeniopygia guttata tgu-miR-365-3p
    43. Takifugu rubripes (torafugu) fru-miR-365
    44. Tetraodon nigroviridis tni-miR-365
    45. Tor tambroides (Thai mahseer) miR-365
    46. Tupaia chinensis (Chinese tree shrew) tch-miR-365b-3p
    47. Xenopus tropicalis xtr-miR-365