v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Alligator mississippiensis (American alligator) Ami-Mir-193-P2b_3p (mature (guide)) URS00003E7283_8496

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAAUGCCCCUAAAAAUCCUUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 54 other species

  1. Anolis carolinensis aca-miR-365-3p
  2. Bos taurus bta-miR-365-3p
  3. Callithrix jacchus cja-miR-365
  4. Callorhinchus milii eshark_mir-365_1
  5. Canis lupus familiaris cfa-miR-365
  6. Capra hircus (goat) chi-miR-365-3p
  7. Cavia porcellus cpo-miR-365-3p
  8. Cervus elaphus cel-miR-365-3p
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-193-P2b_3p (mature (guide))
  10. Columba livia Cli-Mir-193-P2b_3p (mature (guide))
  11. Cricetulus griseus (Chinese hamster) cgr-miR-365-3p
  12. Cyprinus carpio (common carp) ccr-miR-365
  13. Danio rerio (zebrafish) dre-miR-365
  14. Dasypus novemcinctus dno-miR-365-3p
  15. Echinops telfairi Ete-Mir-193-P2b_3p (mature (guide))
  16. Eptesicus fuscus (big brown bat) efu-miR-365
  17. Equus caballus (horse) eca-miR-365
  18. Gadus morhua gmo-miR-365-3p
  19. Gallus gallus gga-miR-365-3p
  20. Gekko japonicus Gja-Mir-193-P2b_3p (mature (guide))
  21. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-365
  22. Homo sapiens hsa-miR-365b-3p
  23. Latimeria chalumnae Lch-Mir-193-P2b_3p (mature (guide))
  24. Lepisosteus oculatus Loc-Mir-193-P2b_3p (mature (guide))
  25. Macaca mulatta mml-miR-365-3p
  26. Maylandia zebra (zebra mbuna) mze-miR-365
  27. Microcaecilia unicolor Mun-Mir-193-P2b_3p (mature (guide))
  28. Microcebus murinus (gray mouse lemur) mmr-miR-365
  29. Monodelphis domestica mdo-miR-365-3p
  30. Monopterus albus Mal-Mir-193-P2b2_3p (mature (guide))
  31. Mus musculus (house mouse) mmu-miR-365-3p
  32. Neolamprologus brichardi (lyretail cichlid) nbr-miR-365
  33. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-365
  34. Ophiophagus hannah oha-miR-365a-3p
  35. Oreochromis niloticus oni-miR-365
  36. Ornithorhynchus anatinus oan-miR-365-3p
  37. Oryctolagus cuniculus (rabbit) ocu-miR-365-3p
  38. Otolemur garnettii (small-eared galago) oga-miR-365
  39. Pan troglodytes ptr-miR-365
  40. Pongo pygmaeus ppy-miR-365
  41. Pteropus alecto (black flying fox) pal-miR-365b-3p
  42. Pundamilia nyererei pny-miR-365
  43. Python bivittatus Pbv-Mir-193-P2b_3p (mature (guide))
  44. Rattus norvegicus rno-miR-365-3p
  45. Salmo salar (Atlantic salmon) ssa-miR-365-3p
  46. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-193-P2b_3p (mature (guide))
  47. Sphenodon punctatus (tuatara) Spt-Mir-193-P2b_3p (mature (guide))
  48. Sus scrofa (pig) ssc-miR-365-3p
  49. Taeniopygia guttata (zebra finch) tgu-miR-365-3p
  50. Takifugu rubripes fru-miR-365
  51. Tetraodon nigroviridis tni-miR-365
  52. Tor tambroides miR-365
  53. Tupaia chinensis (Chinese tree shrew) tch-miR-365b-3p
  54. Xenopus tropicalis (tropical clawed frog) xtr-miR-365