Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla (western gorilla) ggo-miR-32 URS00003E13C5_9593

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUUGCACAUUACUAAGUUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Callithrix jacchus cja-miR-32
  2. Cricetulus griseus (Chinese hamster) cgr-miR-32-5p
  3. Gallus gallus gga-miR-32-5p
  4. Gorilla gorilla gorilla ggo-miR-32 (MIR32)
  5. Homo sapiens (human) miscellaneous RNA
  6. Macaca mulatta mml-miR-32-5p
  7. Macaca nemestrina mne-miR-32
  8. Monodelphis domestica mdo-miR-32-5p
  9. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8209152
  10. Pan paniscus (pygmy chimpanzee) ppa-miR-32
  11. Pan troglodytes ptr-miR-32
  12. Pongo pygmaeus (Bornean orangutan) ppy-miR-32
  13. Pteropus alecto pal-miR-32-5p
  14. Python bivittatus pbv-miR-32-5p
  15. Saguinus labiatus sla-miR-32
  16. Sus scrofa ssc-miR-32
  17. Taeniopygia guttata (zebra finch) tgu-miR-32