Monodelphis domestica (gray short-tailed opossum) mdo-miR-32-5p URS00003E13C5_13616

• 21 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 17 other species
• 50 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UAUUGCACAUUACUAAGUUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

1. Callithrix jacchus cja-miR-32
2. Cricetulus griseus (Chinese hamster) cgr-miR-32-5p
3. Gallus gallus gga-miR-32-5p
4. Gorilla gorilla gorilla ggo-miR-32 (MIR32)
5. Gorilla gorilla (western gorilla) ggo-miR-32
6. Homo sapiens (human) miscellaneous RNA
7. Macaca mulatta mml-miR-32-5p
8. Macaca nemestrina mne-miR-32
9. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8209152
10. Pan paniscus (pygmy chimpanzee) ppa-miR-32
11. Pan troglodytes ptr-miR-32
12. Pongo pygmaeus (Bornean orangutan) ppy-miR-32
13. Pteropus alecto pal-miR-32-5p
14. Python bivittatus pbv-miR-32-5p
15. Saguinus labiatus sla-miR-32
16. Sus scrofa ssc-miR-32
17. Taeniopygia guttata (zebra finch) tgu-miR-32

Publications Download

• FASTA
• JSON