Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Manduca sexta (tobacco hornworm) mse-miR-14 URS00003DE3EC_7130

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGUCUUUUUCUCUCUCCUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Acyrthosiphon pisum api-miR-14
  2. Aedes aegypti (yellow fever mosquito) aae-miR-14
  3. Bactrocera dorsalis (oriental fruit fly) bdo-miR-14
  4. Blattella germanica (German cockroach) Bge-Mir-14_3p (mature (guide))
  5. Cochliomyia hominivorax mature cho-miR-14
  6. Cochliomyia macellaria mature cma-miR-14
  7. Culex quinquefasciatus (southern house mosquito) cqu-miR-14
  8. Dinoponera quadriceps dqu-miR-14-3p
  9. Drosophila ananassae Dan-Mir-14_3p (mature (guide))
  10. Drosophila melanogaster (fruit fly) dme-miR-14-3p
  11. Drosophila mojavensis Dmo-Mir-14_3p (mature (guide))
  12. Drosophila simulans Dsi-Mir-14_3p (mature (guide))
  13. Drosophila yakuba Dya-Mir-14_3p (mature (guide))
  14. Heliconius melpomene hme-miR-14
  15. Polistes canadensis pca-miR-14-3p
  16. Spodoptera frugiperda sfr-miR-14-3p
  17. Tribolium castaneum tca-miR-14-3p
  18. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3348533