Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cochliomyia hominivorax (primary screw-worm) mature cho-miR-14 URS00003DE3EC_115425

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGUCUUUUUCUCUCUCCUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Acyrthosiphon pisum api-miR-14
  2. Aedes aegypti aae-miR-14
  3. Anopheles gambiae (African malaria mosquito) Aga-Mir-14_3p (mature (guide))
  4. Bactrocera dorsalis bdo-miR-14
  5. Blattella germanica Bge-Mir-14_3p (mature (guide))
  6. Cochliomyia macellaria mature cma-miR-14
  7. Culex quinquefasciatus cqu-miR-14
  8. Diachasmimorpha longicaudata Dlo-Mir-14_3p (mature (guide))
  9. Dinoponera quadriceps dqu-miR-14-3p
  10. Drosophila ananassae Dan-Mir-14_3p (mature (guide))
  11. Drosophila melanogaster (fruit fly) dme-miR-14-3p
  12. Drosophila mojavensis Dmo-Mir-14_3p (mature (guide))
  13. Drosophila simulans Dsi-Mir-14_3p (mature (guide))
  14. Drosophila yakuba Dya-Mir-14_3p (mature (guide))
  15. Glossina pallidipes (tsetse fly) Gpa-Mir-14_3p (mature (guide))
  16. Heliconius melpomene (postman butterfly) hme-miR-14
  17. Manduca sexta mse-miR-14
  18. Polistes canadensis pca-miR-14-3p
  19. Spodoptera frugiperda (fall armyworm) sfr-miR-14-3p
  20. Tribolium castaneum tca-miR-14-3p
  21. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3348533
Relationships

Molecular Relationships