Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Salvia sclarea (clary) ssl-miR397 URS00003D9C7D_38869

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAUUGAGUGCAGCGUUGAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

  1. Ananas comosus (pineapple) microRNA 397a
  2. Arabidopsis lyrata (lyrate rockcress) aly-miR397b-5p
  3. Arabidopsis thaliana ath-miR397a
  4. Brachypodium distachyon (stiff brome) bdi-miR397a
  5. Camelina sativa (false flax) cas-miR397
  6. Citrus sinensis (sweet orange) csi-miR397-5p
  7. Cucumis melo (muskmelon) cme-miR397
  8. Cynara cardunculus var. scolymus cca-miR397a
  9. Fragaria vesca subsp. vesca fve-miR397
  10. Glycine max gma-miR397a
  11. Helianthus annuus (common sunflower) ath-miR397a
  12. Linum usitatissimum (flax) lus-miR397b
  13. Manihot esculenta mes-miR397b
  14. Medicago truncatula (barrel medic) mtr-miR397-5p
  15. Musa AAB Group miR397
  16. Nicotiana attenuata microRNA mir-397-like
  17. Oryza sativa (Asian cultivated rice) osa-miR397a
  18. Oryza sativa Japonica Group microRNA osa-miR397a
  19. Populus tomentosa Pto-miR397a
  20. Populus trichocarpa (black cottonwood) ptc-miR397a
  21. Prunus persica (peach) ppe-miR397
  22. Ricinus communis (castor bean) rco-miR397
  23. Rosa chinensis ath-miR397a
  24. Sorghum bicolor sbi-miR397-5p
  25. Theobroma cacao (cacao) tcc-miR397
  26. Vitis vinifera vvi-miR397a
  27. Vriesea carinata vca-miR397-5p
Publications