Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Citrus sinensis (sweet orange) csi-miR397-5p URS00003D9C7D_2711

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAUUGAGUGCAGCGUUGAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

  1. Ananas comosus (pineapple) microRNA 397a
  2. Arabidopsis lyrata (lyrate rockcress) aly-miR397b-5p
  3. Arabidopsis thaliana ath-miR397a
  4. Brachypodium distachyon (stiff brome) bdi-miR397a
  5. Camelina sativa (false flax) cas-miR397
  6. Cucumis melo (muskmelon) cme-miR397
  7. Cynara cardunculus var. scolymus cca-miR397a
  8. Fragaria vesca subsp. vesca fve-miR397
  9. Glycine max gma-miR397a
  10. Helianthus annuus (common sunflower) ath-miR397a
  11. Linum usitatissimum (flax) lus-miR397b
  12. Manihot esculenta mes-miR397b
  13. Medicago truncatula (barrel medic) mtr-miR397-5p
  14. Musa AAB Group miR397
  15. Nicotiana attenuata microRNA mir-397-like
  16. Oryza sativa (Asian cultivated rice) osa-miR397a
  17. Oryza sativa Japonica Group microRNA osa-miR397a
  18. Populus tomentosa Pto-miR397a
  19. Populus trichocarpa (black cottonwood) ptc-miR397a
  20. Prunus persica (peach) ppe-miR397
  21. Ricinus communis (castor bean) rco-miR397
  22. Rosa chinensis ath-miR397a
  23. Salvia sclarea ssl-miR397
  24. Sorghum bicolor sbi-miR397-5p
  25. Theobroma cacao (cacao) tcc-miR397
  26. Vitis vinifera vvi-miR397a
  27. Vriesea carinata vca-miR397-5p
Publications