Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-182 URS00003D5044_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-182: Rno-mir-182 is a microRNA that is upregulated in various biological processes, including myocardial remodeling [PMC5819922]. It has been found to target members of the DNAJ heat shock protein family (Hsp40) [PMC6377737]. The sequence of rno-mir-182 is 5′-ACGCGGGUCUAGCUGCCGGAGGCCUCCCACCGUUUUUGGCAAUGGUAGAACUCACACCGGUA-3′ [PMC5133994]. It has been used in experiments involving transfection to rat neonatal cardiomyocytes and Hela cells [PMC5133994]. In the hippocampus, rno-mir-182 has been predicted to target a total of 475 genes [PMC5832017]. TaqMan miRNA assays have been used to study rno-mir-182 expression levels [PMC6255182]. In different studies, rno-mir-182 has been found to be differentially expressed in various tissues and conditions, including VSMCs exposed to high glucose levels, rat cortex during neurogenesis, and liver tissues in a model group compared with a control group [PMC7248521] [PMC3441217] [PMC6102666]. It has also been associated with the regulation of thecal hyperandrogenesis and target genes such as CTTN have been experimentally confirmed for rno-mir-182 regulation in other diseases [PMC3682887] [PMC4601749].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGGCAAUGGUAGAACUCACACCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications