Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-182-5p URS00003D5044_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-182: Mmu-mir-182 is a microRNA that has been studied in various contexts. It has been detected using whole-mount in-situ hybridization with a specific probe [PMC3183091]. Lentivectors expressing mmu-mir-182 have been prepared for experimental purposes [PMC5031803]. The expression of mmu-mir-182 has been analyzed in different genotypes and developmental stages [PMC3111376]. It has also been identified as one of the dominantly expressed miRNAs in mock-infected libraries [PMC3421232]. Mmu-mir-182 has been found to have regulatory interactions with various target genes, such as RNA polymerase II, TATA box-binding protein–associated factor (TAF4A) and reticulon 4 (RTN4) [PMC3742134]. In the corneal endothelium of mice, mmu-mir-182 expression was found to be decreased with age, while the expression of mmu-miR-34c and mmu-miR-124 increased [PMC3742134]. Mmu-mir-182 has also been shown to be upregulated upon Esrrb downregulation and is involved in the regulation of pluripotency genes [PMC9149258]. Lentiviral vectors for mmu-mir-182 have been used for transduction experiments in cell lines [PMC5491528]. The expression of mmu-mir-182 has also been analyzed in medulloblastomas and its upregulation was observed compared to control samples [PMC3841474]. TaqMan assays have been used to measure the expression of mmu-mir-182 in different experimental contexts [PMC4391288, PMC3841474, PMC4433140, PMC9530455].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGGCAAUGGUAGAACUCACACCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Rattus norvegicus rno-miR-182
Publications