Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3614-5p URS00003D4175_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3614: Hsa-mir-3614 is a microRNA that has been identified in various studies as having a role in cancer. Wu et al. established a risk assessment model that included hsa-mir-3614 as one of the 11 miRNAs used for risk assessment in endometrial cancer [PMC9911505]. Another study found that hsa-mir-3614 is low-expressed in endometrial cancer tissues [PMC9318842]. However, hsa-mir-3614 has been shown to directly target upstream genes to promote cancer cell proliferation and invasion, and its role has been confirmed in renal clear cell carcinoma and non-small-cell carcinoma [PMC9318842]. In terms of prognosis, highly expressed miRNAs such as hsa-mir-138-2, hsa-mir-548f-1, hsa-mir-934, hsa-mir-940, and hsa-mir-4758 are associated with poor prognosis and lower survival rate in endometrial cancer, while low-expressed miRNAs such as hsa-mir-146a, hsa-mir3170, hsa-miR3614 are also associated with poor prognosis [PMC9318842]. In terms of expression levels in endometrial cancer tissues compared to normal tissues, the expression of hsa-miR3614 is highly expressed in tumor tissues [PMC8806668]. The risk score for individuals can be calculated using the expression levels of various miRNAs including the expression level of hsa-miR3614 [PMC8806668]. Overall, studies have shown that the expression level and role of HSA-MIR3614 can have implications for risk assessment and prognosis in endometrial cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCACUUGGAUCUGAAGGCUGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications