Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-15a-5p URS00003D1AE3_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (RefSeq, miRBase, PirBase, ENA, TarBase, MirGeneDB, LncBase). Described in 38 papers. Mus musculus (house mouse) mmu-miR-15a-5p sequence is a product of miR-15a-5p, mmu-miR-15a-5p, 15, miR-15a, miR-15, 15a, mmu-miR-15a, Mir15a genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including (homologous Alu RNA binding protein), 0610007L03Rik, 0610009B22Rik, 0610009E20Rik, 0610009F02Rik, 0610011E17Rik, 0610011L14Rik, 0610025L18Rik, 0610027A18Rik, 0610027D24Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAGCAGCACAUAAUGGUUUGUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 31 other species

    1. Alligator mississippiensis (American alligator) ami-miR-15a-5p
    2. Ateles geoffroyi age-miR-15a
    3. Bos taurus Bta-Mir-15-P1a_5p (mature (guide))
    4. Callorhinchus milii eshark_mir-15_5
    5. Canis lupus familiaris Cfa-Mir-15-P1a_5p (mature (guide))
    6. Capra hircus miR-15a
    7. Cavia porcellus (domestic guinea pig) cpo-miR-15a-5p
    8. Chrysemys picta bellii Cpi-Mir-15-P1a_5p (mature (guide))
    9. Columba livia (rock pigeon) cli-miR-15a-5p
    10. Dasypus novemcinctus dno-miR-15a-5p
    11. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-15-P1a_5p (mature (guide))
    12. Equus caballus (horse) eca-miR-15a
    13. Gallus gallus (chicken) Gga-Mir-15-P1a_5p (mature (guide))
    14. Gorilla gorilla ggo-miR-15a
    15. Homo sapiens (human) hsa-miR-15a-5p
    16. Lagothrix lagotricha lla-miR-15a
    17. Lemur catta (Ring-tailed lemur) lca-miR-15a
    18. Macaca mulatta (Rhesus monkey) mml-miR-15a-5p
    19. Macaca nemestrina mne-miR-15a
    20. Microcebus murinus (gray mouse lemur) mmr-miR-15a
    21. Ornithorhynchus anatinus Oan-Mir-15-P1a_5p (mature (guide))
    22. Oryctolagus cuniculus ocu-miR-15a-5p
    23. Ovis aries miscellaneous RNA
    24. Pan paniscus ppa-miR-15a
    25. Pan troglodytes (chimpanzee) ptr-miR-15a
    26. Pongo pygmaeus (Bornean orangutan) ppy-miR-15a
    27. Rattus norvegicus Rno-Mir-15-P1a_5p (mature (guide))
    28. Saguinus labiatus (red-chested mustached tamarin) sla-miR-15a
    29. Scyliorhinus torazame Sto-Mir-15-P1a_5p (mature (guide))
    30. Taeniopygia guttata Tgu-Mir-15-P1a_5p (mature (guide))
    31. Xenopus laevis (African clawed frog) xla-miR-15a-5p
    32. Xenopus tropicalis xtr-miR-15a