Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) Rno-Mir-15-P1a_5p (mature (guide)) URS00003D1AE3_10116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAGCACAUAAUGGUUUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Alligator mississippiensis ami-miR-15a-5p
  2. Ateles geoffroyi age-miR-15a
  3. Bos taurus (cattle) Bta-Mir-15-P1a_5p (mature (guide))
  4. Callorhinchus milii Cmi-Mir-15-P1a_5p (mature (guide))
  5. Canis lupus familiaris Cfa-Mir-15-P1a_5p (mature (guide))
  6. Capra hircus miR-15a
  7. Cavia porcellus cpo-miR-15a-5p
  8. Chrysemys picta bellii Cpi-Mir-15-P1a_5p (mature (guide))
  9. Columba livia cli-miR-15a-5p
  10. Dasypus novemcinctus dno-miR-15a-5p
  11. Echinops telfairi Ete-Mir-15-P1a_5p (mature (guide))
  12. Equus caballus (horse) eca-miR-15a
  13. Gallus gallus (chicken) Gga-Mir-15-P1a_5p (mature (guide))
  14. Gorilla gorilla gorilla ggo-miR-15a (MIR15A)
  15. Gorilla gorilla ggo-miR-15a
  16. Homo sapiens hsa-miR-15a-5p
  17. Lagothrix lagotricha (brown woolly monkey) lla-miR-15a
  18. Latimeria chalumnae Lch-Mir-15-P1a_5p (mature (guide))
  19. Lemur catta (Ring-tailed lemur) lca-miR-15a
  20. Macaca mulatta (Rhesus monkey) mml-miR-15a-5p
  21. Macaca nemestrina mne-miR-15a
  22. Microcaecilia unicolor Mun-Mir-15-P1a_5p (mature (guide))
  23. Microcebus murinus mmr-miR-15a
  24. Mus musculus (house mouse) mmu-miR-15a-5p
  25. Ornithorhynchus anatinus (platypus) Oan-Mir-15-P1a_5p (mature (guide))
  26. Oryctolagus cuniculus (rabbit) ocu-miR-15a-5p
  27. Ovis aries (sheep) miscellaneous RNA
  28. Pan paniscus ppa-miR-15a
  29. Pan troglodytes ptr-miR-15a
  30. Pongo pygmaeus (Bornean orangutan) ppy-miR-15a
  31. Saguinus labiatus (red-chested mustached tamarin) sla-miR-15a
  32. Scyliorhinus torazame (cloudy catshark) Sto-Mir-15-P1a_5p (mature (guide))
  33. Sphenodon punctatus Spt-Mir-15-P1a_5p (mature (guide))
  34. Taeniopygia guttata Tgu-Mir-15-P1a_5p (mature (guide))
  35. Xenopus laevis xla-miR-15a-5p
  36. Xenopus tropicalis (tropical clawed frog) xtr-miR-15a