v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila guanche tRNA.Pro secondary structure diagram

Drosophila guanche tRNA.Pro URS00003CA718_7266

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGCUCGUUGGUCUAGAGGUAUGAUUCUCGCUUCGGGUGCGAGAGGUCCCGGGUUCAAUUCCCGGACGAGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bactrocera dorsalis tRNA-Pro
  2. Bactrocera latifrons (Solanum fruit fly) tRNA-Pro
  3. Bactrocera tryoni (Queensland fruitfly) tRNA-Pro
  4. Blattella germanica tRNA-Pro (CGG) (tRNA-Pro-CGG-5-1)
  5. Centruroides sculpturatus (Bark scorpion) tRNA-Pro
  6. Ceratitis capitata tRNA-Pro
  7. Drosophila ananassae tRNA-Pro (CGG) (tRNA-Pro-CGG-2-1)
  8. Drosophila erecta tRNA-Pro (CGG) (tRNA-Pro-CGG-1 1 to 4)
  9. Drosophila ficusphila tRNA
  10. Drosophila gunungcola tRNA-OTHER
  11. Drosophila melanogaster (fruit fly) transfer RNA:Proline-CGG 2-2 (Dmel_CR32173, Dmel_CR32200, Dmel_CR32546)
  12. Drosophila persimilis tRNA-Pro (CGG) (tRNA-Pro-CGG-1-1, tRNA-Pro-CGG-1-2)
  13. Drosophila pseudoobscura pseudoobscura (Fruit fly) tRNA Dpse RNA:GA29735
  14. Drosophila sechellia tRNA-Pro (CGG) (tRNA-Pro-CGG-1 1 to 3)
  15. Drosophila simulans tRNA-Pro (CGG) (tRNA-Pro-CGG-1 1 to 3)
  16. Drosophila willistoni tRNA-Pro (CGG) (tRNA-Pro-CGG-1-1)
  17. Drosophila yakuba tRNA-Pro (CGG) (tRNA-Pro-CGG-1 1 to 4)
  18. Rhagoletis pomonella tRNA-Pro
 2D structure