Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila persimilis tRNA-Pro (CGG) (tRNA-Pro-CGG-1-1, tRNA-Pro-CGG-1-2) secondary structure diagram

Drosophila persimilis tRNA-Pro (CGG) (tRNA-Pro-CGG-1-1, tRNA-Pro-CGG-1-2) URS00003CA718_7234

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCUCGUUGGUCUAGAGGUAUGAUUCUCGCUUCGGGUGCGAGAGGUCCCGGGUUCAAUUCCCGGACGAGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bactrocera dorsalis tRNA-Pro
  2. Bactrocera latifrons (Solanum fruit fly) tRNA-Pro
  3. Bactrocera tryoni (Queensland fruitfly) tRNA-Pro
  4. Blattella germanica tRNA-Pro (CGG) (tRNA-Pro-CGG-5-1)
  5. Centruroides sculpturatus (Bark scorpion) tRNA-Pro
  6. Ceratitis capitata tRNA-Pro
  7. Drosophila ananassae tRNA-Pro (CGG) (tRNA-Pro-CGG-2-1)
  8. Drosophila erecta tRNA-Pro (CGG) (tRNA-Pro-CGG-1 1 to 4)
  9. Drosophila ficusphila tRNA
  10. Drosophila guanche tRNA.Pro
  11. Drosophila gunungcola tRNA-OTHER
  12. Drosophila melanogaster (fruit fly) transfer RNA:Proline-CGG 2-2 (Dmel_CR32173, Dmel_CR32200, Dmel_CR32546)
  13. Drosophila pseudoobscura pseudoobscura (Fruit fly) tRNA Dpse RNA:GA29735
  14. Drosophila sechellia tRNA-Pro (CGG) (tRNA-Pro-CGG-1 1 to 3)
  15. Drosophila simulans tRNA-Pro (CGG) (tRNA-Pro-CGG-1 1 to 3)
  16. Drosophila willistoni tRNA-Pro (CGG) (tRNA-Pro-CGG-1-1)
  17. Drosophila yakuba tRNA-Pro (CGG) (tRNA-Pro-CGG-1 1 to 4)
  18. Rhagoletis pomonella tRNA-Pro
2D structure Publications