Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Acyrthosiphon pisum (pea aphid) api-miR-993 URS00003BF529_7029

  • 23 nucleotides
  • 3 databases (Ensembl Metazoa, MIRBASE, RefSeq)
  • Found in 22 other species
  • miRNA

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAGCUCGUCUCUACAGGUAUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Apis mellifera (honey bee) ame-miR-993-3p
  2. Bactrocera dorsalis (oriental fruit fly) bdo-miR-993
  3. Blattella germanica Bge-Mir-10-P4_3p (mature (guide))
  4. Bombyx mori (domestic silkworm) bmo-miR-993a-3p
  5. Cochliomyia hominivorax mature cho-miR-993-3p
  6. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-993-3p
  7. Drosophila ananassae Dan-Mir-10-P4_3p (mature (guide))
  8. Drosophila melanogaster (fruit fly) dme-miR-993-3p
  9. Drosophila mojavensis Dmo-Mir-10-P4_3p (mature (guide))
  10. Drosophila pseudoobscura dps-miR-993-3p
  11. Drosophila pseudoobscura pseudoobscura miRNA FBtr0331076_df_nrg
  12. Drosophila simulans dsi-miR-993-3p
  13. Drosophila virilis dvi-miR-993-3p
  14. Drosophila yakuba Dya-Mir-10-P4_3p (mature (guide))
  15. Glossina pallidipes (tsetse fly) Gpa-Mir-10-P4_3p (mature (guide))
  16. Heliconius melpomene (postman butterfly) hme-miR-993
  17. Nasonia giraulti ngi-miR-993
  18. Nasonia longicornis nlo-miR-993
  19. Nasonia vitripennis nvi-miR-993
  20. Parasteatoda tepidariorum (common house spider) pte-miR-993b-3p
  21. Tribolium castaneum (red flour beetle) tca-miR-993-3p
  22. Triops cancriformis tcf-miR-993-3p
Relationships

Molecular Relationships